Transcript Name :
Phyag_g29
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_468056
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif7.219PS51195
Helicase, superfamily 1/2, ATP-binding domain29.283PS51192
Helicase, C-terminal15PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.5SM00487
Helicase, C-terminal3.8SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-603
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        1812 bases(100 bases per row)
ATGTGGACGGCTCGGCGCCTCTCGTCGCGGGCGGCGGCTACGCGAGGCTTCCACTCGAGCTTCGTCCCATGGGCTTCGAGTAGTTATCTGTCGGACGTTT
CCTTCGCGTCGTTGCCCATCAGCCAGCGGTCGAAAGATGTGTTGACGCGCGACATGGGCTACGAATTCTTGACGCATGTGCAGAAAGACACGCTGCCATC
GGTGCTGGAAGGACGCgatgtgctggccaaggGCAAGACGGGCAACGGCAAGACCATCGCCTTCTTATTGCCGACTCTGGAGCGTATGCTCAAGCACCCG
CAGCCGTCGCAGGGCAAGATCTCGGCACTTGTCATCTCCCCGACGCGAGAATTGGCGCAGCAGATTGCGGTGGAAGCAGTGAAGCTCACGGACGCCCATG
GACTGCGCACAGCCTGCTTTGTGGGCGGCAGCTCAGTGAACAAGGACGTGAAGGAGTTGACGCAATCTGGAGGTATTGACGTGCTCGTGTCCACGCCTGG
ACGGCTGCAGGCGCATCTGGAGGACAACAGCGGGCGCATCCGACAGAAGCTGGAAAAcctgcaggtgctggtgctggacgaagctgaTCGACTGCTAGAT
ATGGGCTTCAGACCGGACATTATGCGGATTATTAGCCATTTGCCCAAGAAACGACAGACGCTACTTTTTAGCGCGACGCTGCCGGCTGCGACGGAAGAGC
TGAAGGATGTTGCACTAAAGGATGACCATGCGTTTGTGGACACGATTGAAGGAGACGACCAACAGACTAACACGCAGGCGGTGCAGGAGTATTTGGTGTG
CGACCTGCAAGATGTTATTCCAGTGGTGGAAGGTGTGCTTGAAGAGCATATGAAGCTGCCAGAATACAAGGTGATCGTGTTCCTGCCGACTGCGCGGGCC
GCACAGTTTATGGCGCAACTTTTCCAGGAAGCTGAGTTCCCGAATGTGTTGGAGATGCATTCGCGCAAGAGTCAATCGGCACGTACCAAGGCCGCTGATG
CTTTccgcaagggcaagaagatgatcATGTTCTCGTCGGATGTGTCAGCCCGTGGCGTTGACTACCCGGACGTGTCGCTTGTCCTGCAAGTGGGTCTCAC
TGATCGTGATCAATATATCCACCGTCTTGGGCGTACAGCTCGTGCAGGGATGGAAGGACGTGGCATTCTAGTACTAGCCGATTTTGAAAAGACGATGCTG
CGCGATCTGGCTGACCTGCCGCTCACTGAACTGGAGCAGCGTCCTCAACTGGATCAGCAGAACTACCGAACTACGCGTACCCTCGCAAATGTCGGTCCCC
GTAGTGACCTTGGGCAATCCGCAGAGAAAGCTTATGCTGCATTTCTCGGGTTCTACAACTCGAATCTCAAGAAACTTGGCATGACCAAAACGAAACTTGT
CGAGACAGGTGAACTCTACAGCCAGCTCATTGGTCTGGAGAAGGtgccgatgctgcagaagaaaacGCTGCGAGCGATGGGGTTGATGGGTACTCCAGGC
CTTATCGCCGCCCCCAAAGTTGCCAGGGGAGGCTTCAAACCAAAAGGCCCCGGAGGAGAGCTGAAGAGATTCTCCAATGAAGATCGGGATAGTTATCGAT
CGATTCATGGCCGAAAAAAGCGCGAGGGCAACGGCAAATTTGGAGggagctcgtggagaacgTTTAGCGACAACGATGCCAAGCCGTCCCGTAGTGAACA
GCCATTCAAGAACAACCGCAACAGTCGAAGCGCCTcacccagcagcaagcgTGAAGGACGCACCCACGGACATAAGCGTTCAGCGAGCCCGGCGACCAAG
CGAAACTACTAG