/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_6a6b2de64686bdf66f79ecf2d9fff4f1 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_6a6b2de64686bdf66f79ecf2d9fff4f1
Transcript Name :
Phyag_g34
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_321830
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain15.004PS50294
WD40 repeat9.472PS50082
WD40-repeat-containing domain8.808PS50294
HmmSmart predictionP-Valprediction_id
WD40 repeat3.9SM00320
WD40 repeat1.6SM00320
WD40 repeat210SM00320
WD40 repeat4.6SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1495
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4682 bases(100 bases per row)
ATGGCCTTGTTCTACGACTATAATGTGGCGGTGCCGGCCAATCTGCGGCAGGTCTGCTCGGTCTGGGGGGAGCTGGACCCGGTGCTCGCCGTCGCGCTGG
AAAATCGAGAgatccacttcttcacggATGAGGCATGAACGTCTCCAAGATGTAGACCATACTTGATTGTAGCTAGAGAGTCTAAGCTTGTGTTCAACAA
TTGATGCCTGGTTATTGCAGGGTGAGAAGCAACAAGGGCTGGAAAGCTACTCGCGCACTGCGGACATCGTCTCGATGGCCTGGCAGCCCCGTGGAGGGGC
TCTAGCTGTTGGTTGGAGCGACGGAATGGTCTCGCTTTGGGTGTTCAAGGAGCGCACAGCGCGCGAGGTGAACTCTCCGCACTCGAGCCGCGTGTGCCTT
CTGAAGTGGGCGCCAGCGGGCAACCGCCTCATGTCAGCCGATGAGAACGGAGTATTTGCCGTCTGGAAGGTGGACAGTCGCTGCCAACTTACGCTCAGTA
CGCAGTATGCACGTCAGGGAAGCTTCAAGCACTGCGTTTTCGCCACACGAGCGAAAGACAGCAATGCCAAAAGGTAGGCAAATAGTGTTATGCTGATACT
GCATTTGTGGTTAATCTGTCCTTATGGCTTTGTTCAGTGATAATTTCTCGCAGCATGCTTGCCCAcagttcttcttcggcggcGAGGCGGGATCAGTACA
CTATGCCGACGATCTGGGTCACATATCGGATATTCAGGTGTTGAATCACGCAATTGAGTCGATGATGTTCTACGAGGAGCAGAGCCGCCTGATTGTCATC
ACGCGGGCGGTACAGCTTATCGTGTACCAAGTGGGGGCAACGGATGGCACGGTGAAACCTATCACCAAGGTCAAACTGAGTCTGGCAGGGGAAGGCTCTC
TGCTTGAGACGAAGTGGGCTGGGCCGGGGCTACTGGCAATCGCGTCTGGAGAACCTCTGGTGCGATTCTGGAATATTCGCACTGAGGAGAACAGCGTCTT
GAGTCTACCAAAGTCAAGTGGGCTCAACTACAACGTCAACAACCTGAGCTTTTCTCCACGGAGACGCATTCTCGTGGCCGGTACTGCTCAGGGAGCAGTT
TTTTTCTGGCGTGCTGCGTCTTTCATCGACCCTACCACCCAAAGCAACACGGATGCAGCAAATGTGTCGATTCGCTGGGACTTGCTCTTCGCGGCTGAAG
TGGGGCGCGCAGTCACTCGCATTGGATGGAGCAATGCACACCCTGTGATATATGCTAACACTGTCGAAGGCGTTGTCATCCTACACGAGGGCAACATGCA
GCGTGCACTCTGCGGTGATACAGCAGTAATGCAAGTGCGGCCAAACACACTTTCTATTGAGAAATTCCAAGACGGAGCACATTCAGGCGTGACCATCACA
CAGTCGATGCTGGAGGCATCGCTACGTGTCAAAGGTGTTTCTCACGATGGGTCAACTCTAGTGGTATGGAATGGCTCTAAAGCAGAAGTGTACGAAGTGA
AGGATGGAGATACCAAGATGATTAACCAGTTCAAGTGCTTCTCAAGTGCCATGGTAGTTCGAGGTGAATCCATTTATCGAGCGCACGGCAACCACGTTGA
AGTCTGCAATCTTGCAGGAGTAGTAAAAAACACGATATCATTTACGGAAGCAGAGGGCAGGCCAGCGATGCTATCACTTCAGAGTAAGTTTCTCGCAGTG
GGAACAGATCgtggtcttcttcgcgtgTTCGACGTATCTCGTCGTGATCCAAAAGCGCTGGGAAGCATGGGTAATCTCCCCGAAGCGTTCGGCGAAGAGA
CCAAGTCTGCAGTGGCGCGATCGATTTGTGTCAACTCTGACGGCACGCGTATCTGCATTCTAGCTGACCGGGTTGAAGGTGGTTTACGAATGCGTGAGCC
ATTAAacaagctcttcttgttccaaACGGACCTCAATATCTATCAACAATTCGACTTTGGCACCTCGCGCTATCCGACTTCTGCGTTCTTCGACCCCCAA
GAGCCACGATTGCTCATTTGTGAGACCGTCAAGACTGGTAACGATGGCGCATCCACTGCAGTGATTGGCAGTGGTAGTCGTCGAGATTTGATAGATGATG
GACTAGGTCCgagtggtggaggtggtgctcGAAATCAAGGCTCGGACAAGGAAGTAACAATCATCTTTGCATCCAACGAGCATGGCCTTCTCATGCAAGA
TAGCTTCGACCTCGATCTCAAGTACTCAGCGTTGCTGGGTATTCAGGTCCCGCGTGTGTACTTCGTAGCAAAGGTGGACACTGGGTCCTCCGATGATTCG
ACCACGATAGTGCACGTTGGTCGAACCAAAGTCAATAATCCCGCCACTAAAACCCCAATGGCTTACGACACGGCTAGTTATCTTCGCACGCAGATCATGC
GTGACTTCACAGGCCTGGACAAGGTCAACAGTGAGGCCAAGCAGGCTCTTATCGACTTCTGCTACTTCATGACGGTCGGTAATATGGATGAAGCCTACCG
CTCCGTCAAACTAATCGAGAACCCGTCTGTGTGGGAGAACATGGCGCGTATGTGCGTGAAGACAAAGCGGTTGGACGTAGCTGAGGTGTGTCTTGGAAAT
ATGGGCCATGCTCGTGGTGCAACTGCCGtgcaggaggccaagaaggaaCCTGAACTGGAAGTTGCAATTGCCATGGTAGCGATCCAACTAGGCTTGCGCG
ATGATGCAGCTCGTCTGTACCGGGAGTGTGGACGTTACGACTTACTCAATAAACTTTACCAGGCCAGCGGGTACTGGAAGAAAGCGGTCGATGTTGCGGC
CAAACGCGACCGCATCCACCTCAAGACAACGTATCACGCGCTGGCGCGACACTATGAGGAAATGGGTGATCTCAAGGAAGCGATGGAAGCCTATGAAGAT
GCTGGCACGCATCAAAAAGATATCCCTCGCATGCTGTTCAAGCTGGGCAAAGTGGATTTGTTGCAGAAGTATGTGGCAACTTCAAACAACCGTGACTTGT
TGATATGGTGGGCTCAATTCCAGGAGAGTCAAGGCCAGTTTGATGGTGCGGTGGACAGCTACCAGCGTGCCAAGGATTATTTGTCTATCGTTCGTGTCTT
GTGCTTCAAGAAGGacttccaagctgcagccaaagTAGCGCAGACAAGTGGAAatcgtgctgcagcttacCACTTGGCCCGGCAATTTGAGGCACACAAC
GAGATCTCAAACGCTATCCACTTTTTCGCGAGTGGCGGTTGCTACAACCATGCAATTCGTTTAGCGAAAGAAAATCGCATGGATGCCGACCTCATGAGCT
TTGCTCTCATGAGCAAGCCTAGCGACATGCTGGACTGTGCCGCATACttcgaggagcagcgcgaAATGGAGAAAGCGGTTCAACTCTACCACAAAGGAGG
CAATGTGGCCAAAGCGCTCGATCTCTGCTTTCAGGCTCAGCTCttcgaagagctgcatcaCCTCACGGACGAACTCAGCGGTTCTGGAAACACGTCGCCT
GCGATTCTGAAGAAATGCGCAGacttcttcatcgcgaaCGGCCATTATGCGAAAGCTGTGCACTTGTGCTTGATCGGAAACCGTGTGGCCGAGGCACTAG
ATGTGTGCATGCAACACGACGTGAAGGTCACAGAAGAGATGGCGGAGAAGATGACCCCACCAAAAGGTGATGACACCGCGTCGCCCGCAGACAAGAAGAG
ACGAACAGAGCTGCTTCTCAAACTTGCTAAGTGCTGCAAGCAACAAGGCTCGTACCACTTGGCCACAAAGAAGTACACACAGGCTGgcaacaagctcaag
gctATGAAGTGTTTACTCAAGTCTGGtgacaacgagaaggtggtgtTCTTCGCCAATGTGTCACGGAATGCCCAAATCTTCGTTCTTGCGGCTAACTACC
TGCAGAACCTGGATTGGCGCAAGGACACCGAAATCCTCAAGAATATCGTGGGCTTCTACACCAAAGCTCGCGCGTTCGAGCAACTTGCGGCTTTTTATGC
TGGCTGTGCTCAGGTTGAGATCGAGGAGTACCGCGACTACGAGAAGGCAATTTCtgcgctgcaagaagctgtaCAAGTGGTATCTAAATCTCGCGCAGAC
GGCAAGGACGCTTTACTGAAGCGCTACGAGAGGCGTATTTTGCTAATCGAACAATTTGTCGTTGCCCAACAACAGGCGAAGCACAACCCGAAGGAAATGA
TGGACATGGTCACGAAATTGCTGGAGGAGCCTGGGATTGAGGAGGCTATTCGTGTGGGTGACGCACACGCCATGTTGGTCGAAGGCTACTACGAAGAGGG
TGAACTGAATAAGAGCTTTGAaacgatggaggagatgatgCGAAAGGGACTCACGATTAAGACGTACGTGAACCCGAGAGTTGTGGAAGCTGTTCAAGCG
AAGCTAGGAATTTCACTGGGAGATGACAAGCGCCGCAGACCTCCACCCAGCGACTACAAGCAgtctgcttcttccagtcgccCCAGCTCTCGTGATGCCA
AATCCAGTCGACCAAGTTCGCGTGAGGCGAGTCGTCCTAGCTCGCGTGAGGCTCATAGTAGTCGCCCGAGCCCTCGCGACGCTGCCATGAGCCGTCCAAA
CTCCCGCGAGGCGAAAATGGGACATTAtgcagacgacgagatcgaagacgaactggaagaagacATCGCCGAGGATGAATAA