Transcript Name :
Phyag_g33
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pumilio RNA-binding repeat25.962PS50303
Pumilio RNA-binding repeat7.427PS50302
Pumilio RNA-binding repeat10.274PS50302
Pumilio RNA-binding repeat7.264PS50302
Pumilio RNA-binding repeat6.471PS50302
Pumilio RNA-binding repeat5.887PS50302
Pumilio RNA-binding repeat5.841PS50302
Pumilio RNA-binding repeat5.164PS50302
HmmSmart predictionP-Valprediction_id
Pumilio RNA-binding repeat3.7SM00025
Pumilio RNA-binding repeat1.3SM00025
Pumilio RNA-binding repeat83SM00025
Pumilio RNA-binding repeat16SM00025
Pumilio RNA-binding repeat100SM00025
Pumilio RNA-binding repeat470SM00025
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-561
NN-scoreoddsWeighted Score
0.5111.2780.003
*** None ***
TypeScore
cytoplasmic609
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
*** None ***
*** None ***
Sequence
        1686 bases(100 bases per row)
ATGGCGGCGCCAGCGAAGACGTCGGGCGGCAAGAGCTACAACAAGGGCGGgttcaacgccaagaagcgtccGGCCAGTGGCGGCAATGGcgaggacggca
agaagTCCTTCATGGACCAGAAactcgccaagaagcagcgcaagatgCAACGCCCTCACTACGAGATGGTGACGCGCGCCAAGCAGATCTGGAACGTGAT
CCGCGAGCGCGacgtggacaagaacaagcGCGCCACgctcgtggacgagctgttcaCGCTGGTCAAGGGCAAGATCTACGATGTGGCGGCCAAGCACGAC
GCGTCGCGTGTCATCCAGTCGCTCATGCAGCACGGCAAGCCCGAGCACCGCTCGCAGATCgtgctggagatgaaggagcacCTGATTgaggtggccaaga
tgcAGTACGGGTGCTTTCTCGTGCAGAAGATGATCCGCTACGGCAGCGTGGCGGACCGTGCAGCCATCGTCAAGTGCCTCACGGGCCACGTCGTGCAGGT
CGGCACGCATAACATTGCGGCCAATGTGCTCGAGTACGCGCAGGAATACCTGAAGCCATCGCAACTCACGGCGCTCAAGCTGGAGTTTTACGGCCGTGAA
TTCGCCTACTTCCACTCGGAGAGCAAGCGCAACCTGGCCGATATTATTGCTGCTCATCcggacaagaaggaagaggtgCTGAAGCACTTGAGCACCATCT
TGAACCGCATGGTGGacaagcagcttcttggactgGCCTtcgtgcagtcgctgctgtgggAGTACATGTGCAATGCggagcacgacgacgtgatGAACAT
GGTGGCCAATGTGCGTGATGCGTCACTGGCGCTGCTTGCCACGCGCAACGGTGCTCGTGTGGTCAACAAGTGCGTTTCGCTCGGTGCGGCTAAGGACCGT
AAGCGTATTATTAAGACTCTGAAGGACAAGGTTTTGGAGGCTTGCAACCACCCCAGTGGCTACCTCGTGATCATGCGTATCCTGGACGTGGTCGATGACT
CGGTTCTGGTGCAGAAATCCATTCTGGCAGAGATGAACGACGAGCTCTTTTCGATTGCGATGCACCCCAGTGGACGcaaaattttgctgcagctgcttaG
CCCCCAGAGCAAGAAGTACCTCTCGGCAGATgacctggagctgctggagcctcCTATGCTGCCGTCGCCTGAGGACCCGACCGCCATGGTGGTGAACTAC
AAGAAGGACCCGGACGCTCGTCGCGAGGAGCTACTCAAGGGCCTGCTGCCtaagctggaggagatgtgCGTTGAGAATGCTGCCGCCTTGATGCGCTCAA
AGGAGGGCCGTGATGTGATTGTCGAAGTCGCTAAGCGTAGCGAGAGCTCGGACCTGGCTGATAGCGTGGCCGTCGCTGTTCTGGCGGAGCCTAGCGAGGC
GGAGGAGCCTCTTCACACTGACGCCAATGGCCACTATGCTTTGCGTCGCCTGATCAAGGAAACCTCGATGGCAGAATCCCTGCTAACGGCGGTTGAAGAC
CAGCTAGCGCAATGGGCGACTAGCAACCGTGGCTCCTTCGTGGTCCTCTCGTTCCTGGAGGCTGAAAATGCCCCCAAGAACGCTTTCAAGGTTGTGAAGA
AAGCACTCAAACCCTCCATGGGAGACttgaagaagctcgtcgaCTCTCAGAAGGGCACTAAATTACTTCTTGAGAAGCTCCAATAG