Transcript Name :
Phyag_g4
Orientation:
(-)
Number of Exons:
5
Description :
elongation factor P, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Elongation factor P, C-terminal5.4SM00841
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-208
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
cytoplasmGO:0005737IEA
*** None ***
*** None ***
Sequence
        961 bases(100 bases per row)
ATGCTGCGTCGAGCAATCACGCACGTTGCGCGGACGACGGCGCCTTCTCGTGGCTGCGGAGTGCGCTTTGCCACGATCAATGGTACCATCCTGCTCAGCA
CCCGACGCGCTCTTTTCTCATATCAGTTTCACCGTTTAACTCATCGAATTGACTCAATTGAACAGGTAATCAGGTGCGAGCGGGTATGGCACTTGAGATC
GACGGCAAAATCTACCGCGTGGGCAAGAATCAGCACGTGAAACCTGGGAAGGGCGGAGCTTACGTCCAGGTGTATACTTTGTCCGTGGAAATCCACGCAA
AATAATCGGATAAACAGCTTACCAGAAGCGTGTATCAATGTCAAATTGCCGCTGTTAggcggagctgaaggagataAAGACCGGAGCCAAGATGAACCGC
CGCTTCCGTGCTGCTGAGAGTGTGAACAAGGCGCCGCTGGGTCCGGATGAGCCGTTCCAGTTCCTCTACTACAACGGAGACCACCTCGTCATCATGCACA
ACGGGACGTTCGAGCAGGTGCgggactgctgctgtgctttagtgtcgttgaagctggacaaTCTAGTAGAGAAATTAATCCATCGCTGCCGGTGTCGCTG
TagatggagatcgagcgcGACCTGTTCTCGGGTCGGCAGCTGGAGTTTTTGCAGGAGGGCatgacgctgtcgctgcagatcGTCGAGGGCGACGTGCTGT
GGGCCAACATGCCCGAGTACGTTACGCTCGAAGTGACGGTGCGTGCAGTTCGTGGTCCATTTCTCTGGTCGGAGGTCTGGCTCTGATTAATGCCGTTATT
TCTCGCAGAAAACCACTGCCAAGGGCGTGGCGGACACGGCATTGAGCGTCAAGgacgcgacgctggagaacggCGCTGTGGTCAAGGTACCACTGTTCAT
CGAGGTCGGCAACAAGGTCAAGGTGAACACGGAGGACGGCGCGTACGTCGACAAGCTGTAG