/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_4998ca8b8c7fc0135437b1bf95b4b97e -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_4998ca8b8c7fc0135437b1bf95b4b97e
Transcript Name :
Phyag_g22
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_426731
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain28.471PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-356
NN-scoreoddsWeighted Score
0.7392.7060.005
*** None ***
TypeScore
mitochondrial391
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1071 bases(100 bases per row)
ATGGCTCTTGTCACCAATGCCCGTATGAAGCTGCATTCGCGGATACAGGAAAGCCTCGATGGTCTCCAATGTGTGGATCTGGTGGAGTGTCCTGTTTCAG
GGCGCGTTTTCATCGACAAGCACACGCTCATGACCTCGTCCACCTTTGAAGGCCGCAACGCCAGTGCCGCTGCACTACATGAATTGGATCTCCACCTCTC
GGTTCGAGATACCGAAAACGTCGTCAAGTTGGAGCAACATTTTTTGCAAGGAGAGCGACTCCATCTACTGCAAGAACACTGCGGTTGTGGAGATGTGCTC
GAAATCATGCAACAAGAACTTCGTCTTCAAACGGCAGGGGTGCCGACACAAAACTCTGCAATATCTACTTGCACCGATGCAGGTCGACGTCGTATCTTCA
CCGCTGTACTTCGAGGAGTTCAGGAACTTCATACCGCCGGAATCGCCCACTTGGATTTGTCGCCGGAAAATGTTTTCGTCACGGAATCCGGTGCTGCCAA
GGTAGGGGATCTGGGCCACGCCCAACGATTCAAGCTCGACCGACCGAGTGTTCAGGTCGAACAAGTAGCGAAAGAGGCCTATGCTGCGCCCGAACTGCTA
cggaagaaggaggtggacgatGCACGTCAAGCTGATGCCTGGTCCCTTGGTGTGATCTTGTGGACGTTGTGCACTAAGCGAGCTTTGGTGCGTCGTGCAT
CAATTGACAGCGACAAACTCTTCTGTCGGATGGCTGAACGTGGCACACTATTTGCTCTCCAGGAGACTGGATTGCTATCACAGGTACCGGATTCATGCGT
CGAGCTGCTAGCTGGTCTCTTGGATGTGAAGCCCAAGTCGAGACTTTCagtggctgcagcgttgcagcaTCCGTGGGTGACTCAGGACACTGCAACGACC
AGGCATCAATCTCGACGAAAGTCCATTGGCAACattttcaagaagaagggcgagGAGTTGATGATGAAACAAAAGCGTCcaagcgagaagaagacacgcG
TTCGCACTGCCAGCGCAGAAATTGGACTCGAGTCGACTCGAGTCACTCTGACATCGCGAAGTCTAGCATAG