Transcript Name :
Phyag_g16
Orientation:
(+)
Number of Exons:
1
Description :
phospholipid-transporting ATPase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase4.7PR00119
Cation-transporting P-type ATPase4.7PR00119
Cation-transporting P-type ATPase4.7PR00119
Cation-transporting P-type ATPase4.7PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-284
353-889
944-972
1028-1038
1099-1201
308-329
910-923
996-1004
1062-1075
285-307
330-352
890-909
924-943
973-995
1005-1027
1039-1061
1076-1098
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        3606 bases(100 bases per row)
ATGGGTGAAGGAACGGCAGGACACGCCGGAGACTTCCGCGTGGTTCACCTAAATGATGCACACCGCAACACTGAGGCCGGTTattgcaacaacttcatcg
tcacGTCCAAGTACACGATAGCGAGTTTCCTGCCCAAGTTCCTCTTTGAGAGCTTCCGTAAACTCTCCAATCTCtacttcctcgtcatctgCATCCTGCA
ATGCATTCCGCAGATCAGTAATACTAACGGgacgccgtcgacgttgccGCCCTTGATCTTTATCATCACGGTTGATGCCGTCTTTGCCATCCTCGAAGAT
CATAAACGTCACCAGGCTGACAACATCGCCAATGCAAGTCCGACACTGGTCTTAGACCGCGAAACGAAGAATTTCAAGCAAATCACGTGGGCGGACGTCG
TAGTGGGCGATATAGTTAAGGTGACAAACCGAGGTCTCGTGCCAGCAGACATGCTCGTGCTAGCAGTTAGTGAGATCCCCAACCAACCCCCGTGCGGTAT
TTGCTACGTTGAAACCAAGTCTTTGGATGGAGAGACCAATATGAAAGTTCGTTCTGCAATGGAGGGCACGTTGGCAGATATGGGTTCTGTCGACAACTTG
CTCAAGATGAAAGGTGTTGTCCGTTGTGAGCATCCCAACAACGCCATCAACAGCTTTCAAGGCGTAATGGAGCTTGAAGGCAAAGAGAAAGCGTCCATTC
CGTACGAAAGCATTATTCTTCGTGGTTGTATTATTCGTAACACGGAATGGGTGCACGGCGTGGTCTTGAACACTGGCAAGGACACGAAAATTATGATGAG
TAACTCGGCTCCACCGTCGAAAATGAGTTCGATGGATCGGTCTATCAACCAGTACACTGTCGTGTTGCTGACGATTTTGGTCCTATTCAGCGCAGCTGGC
GCAATAGGCGCAGTGATTTGGAAAGCAAACCACGATTCCGTGTGGTACTTGCAGCTTGGTGTGTCCGACAACAGCGTATTCGTGGATTGGCTCATCATGT
TGTTTTACTACCTGCTACTCATGTACCAGTTCGTTCCCATTTCCCTGGCTGTGTCCATGAGCATGGTCAAGTATCTCCAAGCTCAATTTATTCAGTGGGA
TATCAACATTTACCACCCGGACACGGACACTCCGACACTGGTGCGTTCCATGTCACTCAATGAAGAGCTCGGGCAGATCTCGTATATATTTTCCGACAAA
ACAGGCACCTTGACATGCAACGTCATGGAGTTTCGGAAATGCTCGATCGGTGGAGTTTCTTACGGCAACGGAACCACAGAGATCGGGTTGGCAGCTCTCA
GGCGCGCTGGTAAACCTATCCCAGACATGACTGCCCAGTCCAAGGGCCCTAAAATTCCTTACGTGAACTTCGACGGCCCCGAATTATTCAATGACATGAA
AGGGGACGCGGGCTCTGCTCAAAAGGGGCGGATCGATGCCTTCTTCACACACCTTGCGGTATGCCATACCGTCATCCCAGAGCGTCACGAGAACTCCACT
GAAATCACTCTATCGGCTTCATCACCCGATGAACAAGCTTTAGTTGCTGGTGCGGGATTTTTCGGGTACGAGTTTGTGAACCGATCTCCTGGTATCGCGC
ACGTCAAAGTTCGTGGCACGGTTAAAAAAtacgagatgctggacgtgttAGAATTCAACAGCACGCGAAAACGCATGAGTACAATTATTCGTCACCCCAA
TGGACGAATCTTCTTGTACTCCAAAGGTGCAGATGTAATCATCTATGGGCTTCTGGCAAAGGACAAAGAAGATGAATCGATCTCTTCCCAGCTCCAGGAG
ATCACCCGACGACACATTGACCAGTACGCTGAAGATGGACTTCGTACGCTCACGATTGCAGTTCGTGAAATCGAGCCTTCGTATTACGATGAATGGGCGT
TGCGCTTCCACGACGCGCAAAACAATCTGAACGAGAttgacaagcgcaagaaggatCTGCCGAATGCGATAGATGAATGTATGAGTGAGATTGAGTGTGG
attggagctgcttggagcCACTGCAATCGAGGATAAGCTACAATCCGGTGTTCCCGACACGATCGCCAACTTGGCATGCGCAGGCATTAAGATCTGGGTT
CTCACAGGCGACAAGGAGGAAACTGCGATCAATATCGGTTTTGCCTGCCAGCTTGTTACGAACGACATGAAGCTTTTCATCATCAATGGGAAGAATGCGC
CGACCCCAGAGATACTTGAGAGCACATTAAGGGACGAAATTGGAGCTCGCTGCGCTGATGTCACCGTTTACCTGGCCTCCCCACCGAGCAAGAGAAGTGA
GCTGCGGGACCTCGCTTTCGTTATCGATGGAGAGACGCTCATGTACGCTCTGCGTGGAACATGTCGCCCACTTCTTGCCGAGTTTTCGCAGTACTGCAAA
GCTGTTATCGCTTGCCGTGTATCTCCCGCTCAGAAAGCCGAGATGGTTGCCCTGATCAAAGAGTATGTCCCTGGCGTCCGAACGCTTGCAATTGGAGATG
GAGCAAACGACGTTTCCATGATCCAAGAAGCTCACATTGGTGTTGGCATttctggccaagaaggcatGCAAGCTGTGAACTCGAGTGACTACGCCATCGC
CCAGTttcgcttcttgcagcgcttGTTGCTTGTTCACGGTCGATGGAACTACCGACGCATGGCACAACTTGTGTTGTACATTTTTTACAAGAACATCCTT
TTTACCGCGGCACAGTACTGGTACACGCTGTTGTGTGGGTTTTCTGGGGAGAAGTTTTTCCTTGAAAGCGGCACGCAGCTGTACAATATCGCTCTGACTG
CGATTCCCATCGTCGCAGCGTCGATCTTGGATCAAGACGTCAATGATGATGTCGCCATGACGTTTCCAAAGTTGTATTTCACAGGACCCCGCGATGAAGA
CATCAACACTCGCATTTTTTCCTTGTGGGTTGTCGGAGCGATTGTCGAGAGCCTCATCATCACGTTCATTACGATTCACAGCGTACAGGCAGCTGGGTAT
GGTGGAGGTAGTCCTTCAATGTGGCTGGCGGGCTTTATCGTCTTCACTCTCGTCGTGACGGTAGCCAACGCAAAGTTGTTCATGTTCCAGAACAGCTTCT
ACTTCTTCAATTACTTCCTTTACTTGGGTTCTGTGTTCGTGTGGATCGTTGTCGCAATGGTGTGCAGTCACGTCACACTCCTCGCTGATCTCACGTGGGA
GCTCATGTTAGAGCAGGCGTTCGGTCTTCCATCTTTCTGGTTGATCTGCTTGTTTGTCCCAGTAGCCGCCCTTTCGTACGCCCATCTTTTCAACGGCGTA
AGATCGACTTTCTTTCCGGAGTATTGGCATCTTGCCAAGGAGGTCATCAAGTTTAATCTTGATCGCAAGCTTCTGCAGTGGAACGATAATAGCAACGCGT
CGGTGGCAGTACCAGCTCGATTACCGCACGCAAAACGATCTGCCAAGAAGAGTAGCTCAGTTATCCCAACTGACAGccgaatgcagcagcacagaaCCAC
GCTTCAGAAGGCATATCACGGGTTTGCCTTCTCCAAAGATGGTTACGCCGGGGCAACAGAAACTCGGCTGCTCATGAGTCGTAGCTCCATCACAAGTATT
AATTAG