Transcript Name :
Phyag_g40
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_467769
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Proline-tRNA ligase, class IIa1.7PR01046
Proline-tRNA ligase, class IIa1.7PR01046
Proline-tRNA ligase, class IIa1.7PR01046
Proline-tRNA ligase, class IIa1.7PR01046
Profile scan predictionP-Valprediction_id
Aminoacyl-tRNA synthetase, class II14.891PS50862
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-604
NN-scoreoddsWeighted Score
0.5435.3090.011
*** None ***
TypeScore
cytoplasmic435
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
aminoacyl-tRNA ligase activityGO:0004812IEA
proline-tRNA ligase activityGO:0004827IEA
cytoplasmGO:0005737IEA
tRNA aminoacylation for protein translationGO:0006418IEA
prolyl-tRNA aminoacylationGO:0006433IEA
KO ID
K01881
*** None ***
Sequence
        2485 bases(100 bases per row)
ATGCACTCGCAAAAGGTGGACTTTGACCATGTAGAGGAAGCCCCGACGCTCAACAATCTGCCACGTTGGTCCaccacgatctcgtccagctggtgttgcc
gccagcaccgtgtCAATGAGTCAGCGCGGCGTGGCACTTGTTGGCGTCTTGCAGCGAAAATGACACCACGAGGCACTTCCAGCAATACACGCAAGAAGCT
CTCTACATAATACATATTATATCACCTGCTATAGTACGGGTCTCTCTCTACACCAGGCCTTCTCTACGTTGAGTCGCTGAAGGTGATctgcgtggctgct
gttcgcATAAGATAGCAGACACCTTGTCCAGATCACGAACGAATTATCGATTCCCTTCCTAGGAAGCCCACCTAGACGCAAAGTTCGAGCACTTGGGGCA
CATCTTCACCTGACCTTCCCCTGAGAAAGAGAACTTCTCATGTTCAATCACCTTGCACATGGTTTTTCGTCCGAAGTAATATGTggtgtacaccacacca
cCAAGCTACTTGCCTTTTTGACGCCGCCCATTTTGCTTGTCAAAATGTGGGCGGTTCGCGCACGTCCTCTCTCCTTGGCGTCTGCAGGGAGGCATCTCTC
GACATCACAGTCAACCCGCTCTGCTCCCTGTGCTCTACGATCTGTACTTTGGGCCCCTACCGAGAAACAAGCGCCTTCCGATGCCGCAGTACCCAGTCAC
CAGCTACTAATACGCGCTGGTTTCGTGCGCAAAGGTGGTCACGGTCTCTTCGCATTGCTGCCGCTCGGTCGCCGCGTGGTGGCCAAACTGGAAGCTCTGG
TCGACGATGAAATGCACAAAATCGGCGGCAACCGCGTGGACCTGACGGTGCTGACGCCCAATGAACTGTGGAAGCAGTCAGGACGTTGGCAGAGTCGCGG
CCCGGAGCTCATGACGCTTGAAGACCGACGCGAAGATCTGTTGGTGCTGGGCCCCACACACGAAGAAAGCATCACGAGTCTTGTCGCAGCTCACTATAAC
ACTGCGGGGGCAGCAGGCTCGTCCTTGAGACTGTACCAGATCGGCCGCAAATTCCGTGACGAAATCCGCCCTAGATTTGGACTGTTGCGAGCGAGGGAGT
TCGTGATGAAGGACATGTACTCTTTTGACGCTACGTACGACGGGGCGTTGCAGACGTATCAGGACGTCACTGCTGCGTATCAAGAAATTTTGATTTCAAG
ACTCAAACTGCCGGTCAAACGTGTTGAGGCTGACTCGGGGAATATTGGTGGCAATTTATCCCATGAGTTCCACGTGCTGGCGGACGTCGGTGAAGACGCA
ATCTTATCTTGTTCGTCGGCGAAATGTGACTATGCAGCTaacgtggagaaggcggaggGGGTGTTGCCGTCTTTGGGGGATGTGTCGATGGAACAGAGTG
ACGAGGTCTCGGCAGAGCTTGGCGCCATCATTGCGCAGCTTGAGGAGCAGGCTCATGCAGGTGATGAAACTATGTGGGAAACTTTGATGGAACTTCAGGA
GATTGCGGGGTCGCAAGGATTCTCGGTTAAGTTTGTtcaagagcaagaggagaGCTATGACCCTAATGCTGTTGAGCAAGACGGTGACGATGCGGACAGC
TCACAGCCCCGAATGGCGTTGTGCTTTACGCGACACGATCGCGAAGTGAATGAACTGGCTGCTAAACCGTTCATCGGCGgtgatgaaggtgaagtgaTTA
AGAACAAAACGAAGGTTGCAGAGCTGCTTGCAAAACGTGATGAGGAAACGGAGCTGTATCTGCTACTGGATGACTCGCTGAAACACGGCGAGCATGCTTC
CCCTGCTGTAAAGGctctttgtgctgctgtcgaggCCCTATCGAAGCAACAGGTGAACACTCACGTTGCGTGGGGCCACTTTCGATTGGCACAAGTTGGT
GACTGCTGCCCTCGCTGCAATGGCGGTGACGCCGCGGTACTCGAAGACAAGCGCGGTATCGAAGTAGGTCATGTTTTCTACCTAGGACAGAAGTACTCGA
AGCCATTTGGGGCGACGTATACGGATGCCAAGAACATCAAGCAACCTCTAGAGATGGGCTGCTTCGGCCTTGGTATTAGTCGActggttgctgcagcagt
tgaagcctCTCATGACGATCACGGCATCGCGTGGCCCACAGAGATCGCTCCGTACAAGGTTCTCGTGATGTCTATCGgtggcaagaagcaggacgacCCC
GTATCCCAAGCTGCATGGGAGATTGCTTGCAAACTTGCTTCCGGCAATGTGGCGGGCCTGGTGAAAGACGACGTCCTCCTTGACGACCGCTGGAAAGAAA
GCCCAGGCTCGAAGTTGGCTGAGTCGGAGCTTATTGGATACCCGTACCGTGTCGTGGTTggcaagcgcttcatcgaGGAAGGCCTCGTTGAAGCGCAGAC
TCGTGCtacgatggagaagacgttccTACCACCAGACGAACTGCCAGCGTACTTCACAGGACTTGTTCAAACTGGCACGTTCTAG