Transcript Name :
Phyag_g36
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-258
NN-scoreoddsWeighted Score
0.8444.9130.01
*** None ***
TypeScore
nuclear783
GO
*** None ***
*** None ***
*** None ***
Sequence
        777 bases(100 bases per row)
ATGACCGAggacgcagcttcgtcgtcgtccaccgcgCTCTCACGGgaccgcagcgacagctccgcATGGCCCTCAGTACAGTCGTTCGAGTGTGGCCCTC
GGCGTAGCGTGTACCGCACCACCGAGAAGTCCGTCGTGTTCCGCGTGCGCACTCAAGAGAAACTGTCAAGTGGTCGAGAGAACCGAGTGACCAAccgaag
cagctccaagcagctgctgcggttgacGCAAGGGGAGAGCAGGGGCGGAACAGACGACAAAGACGTCAAtgagacgctggcggagctctacgacgagatg
gagcgcaaGAAACGGTGGCTGGACGATGAGGACAAGACGTTCCGACgaggccagcagcagttgaagaacCTTCAACGAGAACACGCGGCTCTTGGACGAG
CGTTGGAGCAGTGCAAACACCGCAGGAAAGAGCGCGTTCGTATCCAAAAGATGCTGCGTGGGCCGCAAGTTGAGAGTGGAGACTTTGCCAGCGACAGAAG
CAGTGGAagcgacagtgacgatgacagcaACTACAGCAGCCACAAAGATAATCatcgtcgaagcagcaatggccaccaccaccaccaccaatcacgacga
gatggcgcTAAGAAGGAGCGTAAACGACTGCGAAGATTCCAGAGTGAAGTGTCATTGCggttccagctgctgcagtccgAGAACCGACGCTCCGACCTGC
AAGTGGAAAAGGTGATGGCCGATTTGCGACGCGAGTACGCCGACTCGTGTCTGTTTGGCAACTCGTTGAACTTCTAG