/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_e5d310f5715748c9d5b26dad78ea92a4 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_e5d310f5715748c9d5b26dad78ea92a4
Transcript Name :
Phyag_g28
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_554409
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GOLD9.391PS50866
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6020.70828
InsideOutsideTMhelix
227-242
1-203
204-226
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
*** None ***
Sequence
        871 bases(100 bases per row)
atggcgctgggacgactgctgcgtgtgtTCGCAGCCTCTGTCGCtgtgctggtggcggtggcaccAGCCCCGTCCGACGCTATGATCGTGAAGCTTGACG
GCGCCGTGGAGGAGTGTTTCCACGAGTACGTGCGTACCAAACGCACGGCCTTCATGAAGATCGGCGTGCTGGAGTCCACGGGCGCGTACGACGTGCGTCT
GAAGGCGTTCGGCCCCTTCGCCGCGTACCCGGAGCAGGAGGTTGTGGACAAGAACTTCTTCGACCAGATTGTGGTCACGCCGCACGACGAGACGAACCAG
AACGTCGAGCacagcggcttcaacttcgagTCGGAGCACCGCGGCGGATGGTACCGCTTCTGTTTGGATAACAGCCATgacggcaagaacaagatcGTCG
AGTGGTACACGTCCTTCGACCTGTCGAACGAGGAGGATTTGGGCGAGGAGGACAAACTGGACCAGCAGGTCCGTCAAGGTACGAACTGAGCTTGGTGCTT
TGAGATATAGGAGAGGTTTTGGAATATCTTACCGACGTATTTGGGCCATTCAGAGCACATGGAGGGCGTGAAAACGTCGCTGGATCGGTTGCAGACGCTC
CTGAAGCTCATCCGGAACGAGCAGGACTACTACCGAGCTAGAGTACACCGCCACGTTCAGAGTAAGCTTCAAGTTGGTGAAATTGGGCACGGATGCTAGG
GCTAACGGTGTGGTTATTGTTATTGTAGcactcgacagcagcaagtcacGTCTCATCTACTACACAGTGTTCGAGCTGGTAGTGTTGGGTGCAATGTACG
GTGCGCAGTCCTTCCTGCTGCACAAGTGGTTCAGCGACCGCGGCTACATCTCCAAGCGCCAGTGGGCTTAA