/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_a3a34cfae281f67c0cf87b7cac81595f -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_a3a34cfae281f67c0cf87b7cac81595f
Transcript Name :
Phyag_g8
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_554387
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related10.237PS50178
HmmSmart predictionP-Valprediction_id
FYVE zinc finger0.0012SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-667
NN-scoreoddsWeighted Score
0.6842.2370.004
*** None ***
TypeScore
nuclear870
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        2004 bases(100 bases per row)
ATGACAGACTACAGCCCGACGCTCTTGGCTGGGGCCCCCTTGACCCCTCGCTCGCTCTCGAGCTTCGGGTCCTCGCACGGATCAGACCACACCGACGATA
GCGACGCCGAGGACACCTCCGAGATGTGCGTcaaggagcgcgagcgtCTCACTACAGTGGCCAAGCGCATGACCGAGAGTCTTCTGGAAGCCACCGACCT
GCTCGGTGGAATTCCGTGGTCGCTGGTCCACGAAAAGCACGGCGTCTCGCTCTTCCGTGCTGATGCGACCAACGCCTCGACAAATGTGCCCTGCAACGTG
CACGCGGTGTGCAAGTTCGCCTGCGATATTGAGGACGTCGCGGCCTCGCTCATCACGCCCACTACGGCGTCATTCAAACGGATGATGTCCATGTTGTCCT
CGGACTTCCTGGACGGCGCAGTCGTGCAGAACATCGTCGAGCCCACGCCGGCGAACCCTCACCGCTACGTCGCGCTCAAGTGGGCCGCCTTCAAGAGCTC
GGGCCCATTCGCCAAGGACCGCGACCTGCTCATGCTCGAATATGTCGACATGATCGAGGACGCTCAGGGACAGATGACGGCTTTCCGCATCATGGAATCC
GTCGACACCCCTGCAGGGTACCCCAAATACGCCGAGTCGCCCAAGTTCACGCGTGACCTGGTCCCGCTCATGGGCTTCATGTATCACTCGACCAAGCGAT
CAGGTGAGCTGCGCATGACGTATACGTGCAATTTCGACAAGAACGGCGATATGCCGGCGTGGATCGCCAACTCGGCCATCCAGTCGCACGTGGAGAAGTG
CATCAACGGCATCCTCAAGTACACTGAGAACTTTCGTGTAGGTCGAGAGGAGATCGTGCTTCCGCAGCAAGTGGTCCCCATGAGTGAACAGGATCACTGC
AAAATGTGCAACAAGAAGTTCTgtgtgcgtcgtcgccgctaCAACTGCCTCAAGTGTGGAGAAGTGTGCTGCAGTTCATGCAGTTCGGTTCGTAGTGCCC
ACGTGCCCGACGTCGGCGAGCGTCAACTACGAGTCTGCACAGCGTGCGTCATTGAATCACGTCGCAACGCGCGTAACACCGCAAGTGGCTTGGAGTTGCC
TGGTACTCCATCGTTCAGTTCCACCACCGGGTCGAACCAGTTCTTCCCCGACGCGAACGAGCCGAAGCGCTTAGGTCGTGCCCAAAGTTTTTCAGTCCCC
AGATCCGACGTTAAGGAAGATACTCCGCCAAAGCGCCGGTCGTACGACAACCTCCTTGACCCCGTGCGCTCGCGTCTCATCGAGTACAAGACGTTCTCGT
CAGGCTCCGATGACGGCCACGGGCTAAGCGCCACCGTTGCAGGTTCATCGATCGGTGTGCCCAAGGCGAGCTTCCCGAGTCGCTCCTTCAGCGATGGTCT
TGTGATGCGCAACAAGGCTCTGTTTGCAGCTAAACGCCGTGGCAGCCCAGCAGACTTGGCCATCTCGCTTGAAGCCTTCCGCTTACACCAAATCCGCATG
GGCAACGCCGATCGCCAGCCTGAAGATGGCTCGGAAGACAACGACCacacggacgacgagtccaccacgtcgactTCGTCTACATCACCCACGTATGCGA
TCACGAGACCACTACGAATGCATGAACGGGTTACATCGAAGAGCGGTATGAGTACGCGCACTGTTCGTTCGCGCATTCAGGTCAACCCCGAGAGCAACCA
AGACACGCCGGTACTCGAAGACGGTGAGGAAAAGTTCGAGTTCAATGAGGCCGTGGCACGCGCCAACCACATTATCGTGGCTGCCAACTACGCCCATACT
TTAGCTCAGCAAGCTCGAAAGCTTTCGCACTTTCGCGTGGTGGCGTTGCAACAGGAACACGAGATCATGGCACCAGTGCTTCGAAACGGCGGCAACGACC
CCAAGAGCAACAGTTCAGTGGTGCGTCGTCGACCTCGTCACCGCCGGAATGGCAGTGACTTCGAAGTGggtgcaggtgctggtgccgTGCTGTATTCCAA
CTAA