/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_aba20135677ddb63fbf1c39991fbabcc -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_aba20135677ddb63fbf1c39991fbabcc
Transcript Name :
Phyag_g30
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_309064
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7150.8417
InsideOutsideTMhelix
640-648
1-616
617-639
NN-scoreoddsWeighted Score
0.7451.0940.002
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        1947 bases(100 bases per row)
ATGAGGACTCTGCTCGCGACGCTTGCCTTGTTGCCGCTGGCGAAGGCCTGCACCATGATCGCGGTGGGGCGCAATGCGACGGTGGACGGTTCGACGCTGG
TGGCTCACACGGACGACGCCGGATTCGGTGCCGCCGACCTGCGAATGGTGCAAGTGCCTGCCCAAGACCACGAGGAAGGAGCGATGCGGCACGTGTACAA
CGTTCAACCAGGCTACCCTCGACTGGTGACGACGCAACGTGGACCTGAGTACGCACCAAAGAATGACCGAGAGAAGCTCATGACACCACTTGGGGAGATC
CCCCAGATAGCGCACACTTACGGCTACTTCGACCAGGACTACGGCTTCATGAACGAGGTGCAGCTCAGTATCGGAGAGAGCACAAGCGGTGGGAGGACGG
TGGGCTGGCCCACAGACGCTGGATCTCATGGATACAACATGTTCGACATCAACGAGCTCACCaaagtggcgctggagcgCTGCGACTCGGCGCGTTGCGC
TATTCAGACCATGGGCGATCTGGCTGTCAAGTACGGATTCTTCAGTGAAGACAGTGGAGACCCGGCCAAACCGGATTACGTGAGCTCAGCGGAGACGTTG
GGGATTGCCGACCGGTACGGAGAAGTGTGGGTCTTTCATGTCCTCACGGGCCCACAGAATGCAAGTGCTGTGTGGGCTGCACAGCGTGTACCGGAAACTC
ACGTAGTCGTGGTGGCCAATGGCTTTGTCATTCGCGAAATGGATCTGGGCGACTCGGATCGCTTCATGGCGTCGGATAATGTGCTTTCGTTCGCTGAAGA
GATGGGGTGGTGGGATCCGAAACAAGGTGACTTCGACTTCACCAAGGCGTACGCTACCCCAACTCCAGATCCTGTGCGCGCGTTGTACATCGGTCGTCGG
ATTTGGCGAGTGTATGATCTCGTGGCGCCATCCTTAAACTTGGATTCTCGCCTTGGACACTACCCGGAGTTCCCAACATACCCTTTCTCAGTCAAACCGG
ACAGGAAGCTCGATGTTTCAGACGTGACAGGATTGCTCCGCGACTACTTCCAGGGCACGCCTTATGACTTGAGCAAGGGTCTTGCTGCGGGGCCGTTTGG
AATACCGATGCGTTGGGGAGGCGATGAAAAGGGCGTCGTAGGTGGGTGGGAACGACCGATTTCCATGTACCGCACGGTTTTCAGCTTTGTGCTGCAGGCA
CGTGCTCACCTCCCCGACGCTGTAGGCGGTGTGGCTTGGTACGGCCAAAGCTCACCGCATGCGTCGGTGTACGTACCATTCTCCTGTGCGCAGGAGCAAG
TGCCGTCGTCTTACGTCCTCGGAAAGGAGAGTAAGTTTACTCACGGTTCGGCTTGGTGGGCTTTCAGCTTTGTGAACAACTGGAGTATGATTCGCTTTGA
TGCTATCAGCAAGGACATCCGCGCTCGCATTgttgagctgcagaaggcTTGCTTTGTTGAACGTAACGCGATGGAACACTATGTCATGCACACTGAATCC
TTAACATCAGTCGACGCGCACAAGTACCTGCAGGAACAATCGAATCGATTGGCTTCGCGAGTTGTCGAAGAATGGTGGACGTTTGCTTGGAAACTTGTTG
GCAAATTCACGGACGGCTACATTACGATGGGTGAAGCTCCAGAGGAAATGGAGATGCCCGGCTACCCGGAATGGTGGCTCAAGCTCAGCGAGTTCTCCAA
GTGGCCAGGTGAAACATTGATACCACCACCCGTCCCAGAactggtgaagcagctcgagttgtTTAAAAGTCGCCAAAATGTTAGTGCCAATgttgtggtg
cagcagtctgctgctggtggcagcGCAACGACCTCGAACGCTGTTTCAGTCGTTCAGATTGGCGTCGGTGTTGCTATTGGGGCTGTCATTGGTGCTTCCG
TGACGTGGTCTGTTGCACGTCGATCTGGGTATCGGTCCATTGCCTAG