/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_64b30f830107ce4208938405bcd82121 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_64b30f830107ce4208938405bcd82121
Transcript Name :
Phyag_g25
Orientation:
(-)
Number of Exons:
1
Description :
U4/U6 small nuclear ribonucleoprotein Prp31
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Nop domain35.343PS51358
HmmSmart predictionP-Valprediction_id
NOSIC2.6SM00931
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Nop domainIPR002687
NOSICIPR012976
*** None ***
InsideOutsideTMhelix
1-535
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K12844
*** None ***
Sequence
        1608 bases(100 bases per row)
ATGTCGACGCTCGCGGACTCGTTCCTGGAGGACCTGGATGAGCTCAGTGggggcagcagcgacgaggaggagacgccgaCGACCTCCTCTGCTCCTGGGG
CTGCCTCATCCGCCGACGCCGAAGCTGAACACGATGATGACGCAGACGAAGAGATGCCAGAGGTGTCCTCCACCGTTCGAGCAGCCAAGCGGAAGCGCCC
AGACACAGAGCAGGAGTTAACAAAGGTGGAGAAGACCGAGGATATCGCCGCGTCACTCCGTTCCAGCGTCAAGCAACGTGGTGTAGCAGCTGTGGCGACG
CTCAAGCGGTCGCCCAAGTACTTGACACACGTTCAAAAGATCCAGCAATACGCGGGTgtggacggcgctgctgctgattcaGCCAAGCCCCAACACTTAG
AGGAAGGCAGCGCCGAGTACGAACTGGTGGTGACGTCCAACGACCTGATGGtgcagatcgacgacgagatcgaagCTGTGCACCGCTTCATCGCCGACTT
GTACGCTGCCAAGTTCCCCGAGCTCGACTCCCTCGTGCCCAATGCACTGGACTACGCTCGTGTAGTGCAAGCTATTGGCAATGAGATGGATCTGACGCTT
GTGGAAAAACTACCTAAATTGCTGCCTAGTTCTGCAGTTATTGGAATTTCCGTGACGGGTTCAGGTACTAGCGGTAAACCGCTGAGTGCAGAAGACCTGA
AGACATGTCTGGACGCTTGTGACGAactgctgtcgctggacaaggacaagaacatGATCCTGCGCTTCGTGGAGAGCCGTATGAAGTACTTAGCTCCAAA
TGTGTCACAGCTGGTGGGCACACGCATTGCGGCGCAGCTTATCGGACTTGCTGGTGGTGTGGCGCATCTTGCACGGATCCCGTCGTGTAATCTCCAGGTG
TTGGgacaggagaagaaggtgttgaGTGGTTTTTCatcggctgctgcgcttAAGCATACAGGCGTGCTGTTCTTTAGTGACCTTGTGCAGAGTGTTCCTC
CGTATTTACGCATGAAGGCATGTCGAGCAGTAGCAGGCAAGCTTGCGCTGATGGCGCGCGTGGATAGCCAGCCACACCAGAACGACACTGAAGGTCTGGT
GGGAGCGCGCTTCCGTACTGAGCTTGTTggcaagatggagaagtggCAAGAGCCACAGAAggccaagacgaagaaggcgctgccTATTCCTGACGAAAAA
CCGCGCCGCAAACGTGGTGGCAAGCGCTAccgcaagatgaaggagcgacTACAGATGACAGATGTGAGGCGCGAAATGAACCGGCAGACTTTCGCTACGG
CCGACGAAGAGTATGGTGACAATGCCATGGGAATTACCTCCGGTCGCCTTGGTCAGGAAGGATCAGGCAATCTGCGCATTATGcgcaaggagcagaagca
gtcgagcaagaagttgCGCGCTGCGAACTttgctgcatcttctgctAGTAAACCGCCGCTTTCCGGGCTGGCATCGAGTCTTGCATTCACACCCGTGCAG
GGCATTGAGCTCATGAACCCCGTAGCTGCGAAGGCTCGCGTCGCCGAGGCCAATAAGAAATATTTCTCTGCTGCTAGCGGGTTTGTGAGTGTTGTCAAGA
AGCCATGA