/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_c7ac2a72d087b00f490c5bba29f393a1 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1642459 -w 120 -web -o /tmp/images/bd_log_output_file_c7ac2a72d087b00f490c5bba29f393a1
Transcript Name :
Phyag_g31
Orientation:
(-)
Number of Exons:
1
Description :
HSF-type DNA-binding protein, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding9.2PR00056
Heat shock factor (HSF)-type, DNA-binding9.2PR00056
*** None ***
HmmSmart predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding1.1SM00415
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-241
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
transcription factor activity, sequence-specific DNA bindingGO:0003700IEA
nucleusGO:0005634IEA
regulation of transcription, DNA-templatedGO:0006355IEA
*** None ***
*** None ***
Sequence
        726 bases(100 bases per row)
ATGAACGTCCAAGACCTTCTTTCGGCCCCCGAGTGTCCCCCGTCGCCCGCGAcgtccgtctccagcagctccagctcgtgccaggaggaggcggcCCCGA
AACGCGGCTGGGTGGCCCCcttcctgctgcacctgcaccagaTGCTGCGCCGCGAGGACTCCACTATCGTCCGCTGGGCCGAGGACGGCATGGCCTTCCA
GATCCTGGACAAGGAGGCGATGACGGCGCGGATCCTGCCCAAGtacttcaagaacaagaacttctcgagcttccagcgccagctcaaTTACTTCGGCTTC
CGCAAGTGGAGCAAGGCCCGCGCGCAGTTCCCCACCTACAGTCGCGAGCACTTCACGCGCGACAACTACAGCGAGATGTCGCTCGTCAAGCGTCAGAGCA
AGAAGTCTCGGAAGCGCAAGTCCTCGTCCGATGACGAACAACCGGCCAAGCGCGCGGCTGTGGCGTCATCTGCCTGGGTCGCTGGCGAGAAATGCAAACA
CATTCTCCCGCGCCCAGGCGCCGCCCCCGAGCCGGTTGTGGCCCCGTACCAGCCTCGCGTCATGTCCCCGCCGATGCACCCGGCGCCGCTGTTCGATCTC
CCGGTGCTCTCCCCCGCCCGCAAGAtcagcagcggcttcaagCTGCCGTCCATCCGcgagctgtcgctgtccagcgCCATGCCGTACTCGGCCATCGGAC
CCATCCTACCCCGCCTCATGGCCTAA