Transcript Name :
Phyag_g18
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
GTP binding domain1.4PR00326
GTP binding domain1.4PR00326
GTP binding domain1.4PR00326
GTP binding domain1.4PR00326
Profile scan predictionP-Valprediction_id
Protein kinase domain42.845PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain9.6SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-943
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
GTP bindingGO:0005525IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        3276 bases(100 bases per row)
ATGCTGCGCGTGTCCAACCTGCTGCGAGGCTTGACGGGGGCGCCGCTACGTCGTGGCTCCATCCTCAATCGCTCTTGTGTGCGCGCATTCAGTGTCCAAa
atggtggcgatgaagacgacgaagatgacgaatacttggagctggactgggacgacatcgacgacgactttgGCGACGACTgggtgctggaggacgacgg
cgacgtggcctCTGCCGGACGCCGCAAGGTCGAGGAGCATGTCAAGCAGAAAGTGAGTGTCCGTCGCGCGAAGCATTCGAAGCGCCGCTTCGTGGACCGC
ATCCGCGTGAAAGCCACCGGCGGCCACGGAGGCAACGGATGCGCCAGTTTCTTCGCCGAGTCGGCGATCCGTAAACGCCCCAATGGCGGAcacggaggag
ctggaggtgacgtTGTGATTGAGGCCAGTGACAAGATGCAGAACTTGGCAAACGCCACACACCACTTCAAAGGAGGAGCAGGCACCAACGGCATGCGTAC
GTGCAATGGAAGTTGCAGTGTTTTTGAGGACGATTTAGTGGTGTTGACATTGTTTTACTGGGTTTTGTGGCTGCAGCTAATGATTCTGCTGGTAGGAGAG
GCAAACACTGCCATGTGAAGGTGCCGTGCGGTACGCTCGTCAAGCGTGTGGAACGCTACGAGCGTGAGCTGGAAAATGGCGAGTGGGAGACCGTGGACCG
GATGCAAGTCGTGGCCGATTTGGACAAACCTGGGGCTTCGTTCTTGGCTGCGAAGGGTGGCAAGCCTGGATTGGGCAACCGTATTCTGGCGGGTAAGACG
ACCAAGTTTGGACGGCTGCGTAAACACATGCCCGAGAACAAGACGACCGGTTCGCCTGGTACATCGCAGTACTACGAGTTGGAACTCAAAACGATCGCTG
ATGTTGGACTTGTGGGATACCCCAATGCGGGCAAGTCAACGTTGCTGAGTGTGCTGAGTCGCCCCACACCTGAAATCGCGCCGTATCCGTTTACGACGCT
TCACCCGTACGTGGGTATTGTCGAGTTCCCGGACACGTACCGGTTGAGTGTGGCTGACATCCCCGGGCTTATTGATGGCGCCCACCGCAATGTCGGTCTT
GGCCATGACTTCCTGCGCCACATTGAGCGCACAAAGGTAAGCTGTTCAAAGTTGAACGCTGTAAAGTACCGGGGATTTTATCTGATGTGCATGGTTTTCG
CTAGATCTTGATGTACGTCCTGGATACGGCCGGCTCTGAGGGACGTGACCCTCTGGAGGACTTCAAGCATCTGCAACGAGAACTGGAATTATACGCTCCA
GGAATCTCGTCACGCCCGTCTCTCATTGTTGCCAACAAGATGGATGAGCAAGGTAAGGATTTAACGCTGCCCAGTTAATGAGTTGGCGCTAACGATTATT
ATCTGCAGGTTCTGAAGACAATTTTCACAAGTTGCGCAAATCTACGGATCTAGCTGTGCTTCCAGTCAGGTAGGCTCCAACATAACGCACTCGCCCCACC
ACAGTACTAATAACGCCTTCTCAATATGCATTATCAGCGCCCTCCACAAGGTTGACATTGATACCGTAGCACGCACGCTCCGCTGGATGATTGAGAGTTA
TGCCAAGCTTACCAAATCCTCGTAAAACGGGTGCGGTTGCCGCCTTGGGCTTATGCTGTCAGCGCAATAGGAAAAGATGCTgccatcatcgccatcatga
CTTTGTGTGTACTTTGCTCGTGCTGCGATGGTTATTAATAAGGTTGCGGTCGTGATTTCGTGCCAATTATGTTTTACTAGTACACCGCCCAAGGCTTGCA
GCAATTCCGGTGCCAGCCAAGATGAATCGCTATGAAATGCTGGAGCGAGTCGGTGATGGTGCTTTCGGCGAAGTTACGCGTGCCCGCAGTCTCAAGACTC
ACGAAATTgtggctgtgaagaagatcaaggcgGTGTTTCCCACTTGGGAGGAATGTCTTCAGTTGCGTGAACTCAAGTCGCTGCGGGTACTTCGTCATGA
AAATATTGTGCTTCTGAAAGAAGTCATTCGAGACAAGGAGGAACTCTACTTCGTGTTTGAGTACATGCAGACGTCACTTTTCCGCGTCATGCGGAACTTT
AAAGCTGGATCAGGAGCTGAAACGAGTTCAAGTGCGGACGCGTCCACTACATCATGGACTTCAACACCTCCACATCCATGGTTTTCGGAGGTACAGATAC
GGTCGATCATGTTTCAGCTTTTCTGCGGTTTGGCGTACATGCACAAACACGGCTACTTCCACCGCGACATCAAGCCCGAGAATCTGTTGTGTAACGATGA
AACACTTAAGATCGCTGACCTGGGTCAAGCTCGTGAGATCAGATCGCGCCCACCGTTTACAGACTATGTTTCAACACGATGGTACCGAGCACCTGAGCTG
TTACTTCGGTCGACGACGTACAACAGCCCGATCGATATGTGGGCTTGCGGTTGTATCTTGGTTGAGCTGCTGATTTGTACGCCGCTGTTTCCTGGGACGT
CGGAGGCAGATCAATTCTACCGCATCTGCAAGGTTCTTGGTACGCCCACCAACGAAACGTGGCCCGAGGGTGCAGCAACGGCCTCTCACATGCAGGCGCG
CTTTCCTAAATGTGCTCCTGTATCGTGGAAGCGATTCCTGCCCCCAGGTACACCACCAGCTACTGTTCAACTCGTGCGAGATTTACTGCAATATGACCCA
AGCCGACGTATTACAGCGgcgcaagcgcttcaacacCACTTTTTTGATCAAGCCGTGACACGACCGACACTAACGATTCCTCCGTTGGTGATGCTAGAGC
AAGAAGTGCCCGTGTTGCCACTTCGAAGTGAATACAAGTCTGTCGGAGGGTATTCGAGTTACACAGGGCGACAAAGTGTCGGTGCGAAGAAGTTAGATGA
GATTCAAGCCTCAGCAATGGAGACGTCGAGTCATTGGGCTGGAGGTGGATTATCATCGCGACAAGAGCACCACTTGTGGACAGCCAAAGAGCGACAGCAA
ACGCACGTTCGCCATCAGGAATGGGGGTCTTCACTTGTTAGTGCTCGCCTTGGAGGATACGATGAAACAGCAGACGTGAAAGCTGTGACATCAATTCAAA
GTAATGGAGGTCCCTTCAAAGGAAGCTCAGTGAGGAaaagctccagcttcaacgcaCTTGTGAACGAAGATGGAGGTCTTTATTCCACGAGAAAATGCAC
GTCTGTGGACACCGGCGAAGACGACAAAAGCGATAACACGCTACTGCAAGACCTACTCGATGAGATTCTAGGCTAA