Transcript Name :
Phyag_g13
Orientation:
(+)
Number of Exons:
1
Description :
myosin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain8.1PR00193
Myosin head, motor domain8.1PR00193
Myosin head, motor domain8.1PR00193
Myosin head, motor domain8.1PR00193
Myosin head, motor domain8.1PR00193
Profile scan predictionP-Valprediction_id
Calponin homology domain12.387PS50021
HmmSmart predictionP-Valprediction_id
Calponin homology domain1.7SM00033
Myosin head, motor domain1.7SM00242
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1476
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        4431 bases(100 bases per row)
ATGACGGTGCGTCGcacggaggagctgcaggagtgGATCTGTAGCGTCACCGCCACGTCCAACGACCATGGTGAGCACCTGTCGGTGATGCTGCGCGACG
GCCAGTTGCTGTGTCTGCTGGCCAACGGCGTGGACCCCAAGGCCAATCTCAAGGTGAACAAGCTCAACACGGTCTTCCACTCGAAGGCCAACATCCGGCT
CTTCCTCGAGTGGTGCAAACAACAGGGACTCAATGAGGGCGACATTTTCCAGCCCGACGACCTCTTGGACGCAGGTGCAGACTTTAGTAcagtgctggag
acgctctCCATTCTCTTCGACAGGTTCGGCACGATTGGCTACACGGGGGAGTACGAGGAAGACCCCGTTTCAGATGCAGAGTCCATGACGTCCACCGGCA
GTTCGCAGGGCGCGTCGCCGGTCAAGAaaaccaacagcaacaacaaactCACAAACTTCATGAAAGGGGGATTCttgtcgaggaagaagaaacagtCGAG
taagaaggtggtggacaagtCCCCGGAAGGAACTCCGCCATCCACGCCTCCCCCAATGTCGCCGCAGGTGGGAGGAGGGATGATGTCTCCGTCGGGATCG
CCGCCTTCGCCGTTGGAGCCACCTCCGCAGAAGGACACGAGGAGCGACAGTGGAGGTGCAAATTCAAACCGATTGAACGCGTTCCTGAGTCAAGTGCCGG
CGTCACACGGATCGCCGTTGACGCACGCGGATCGTCCCTCGGGCCCACCCAAGAAGGCGAATTCCGTGAggaagccgccgccacccAAGGCAAAGCCGCA
ACCTACTGTAAGGAGACCGCCGTCGCCTAAACAGCCCCCTAAATCGGTGCCATCCGGTGGTGATGCCCGTAACAAATTTGCGGCGTTCATGAAGTCCAAT
CCGACACCTGCTTCGGGCCCGTCCCAGGGGTCTGGTGGCTCCAAGCCTGCTTCCCCGCCGAAGTCGGAGCCTGTACGAGATCGCGGTACGTCAAATGATC
AATTCGCGCAGCGCAAGGCTGTCTTCACGCAAGGTAACAGCAGCCCGAAACCGgacgctcctgctccgtcgAAGCCATCCGTTGACACGGGTAACAAGCT
TAACAGcttcatgaagcagcaaccgTCCGCGTCGCCCGCTTCCTCATCGAAACCTCGCTCGCAGAGCAAGCTGGCTGCTTTTCTGGCGCAGACGAACTCA
ATCCCCTCGATTGCGACGAACCCGTCTGCCGCGCCGTCAAAACCGACGTTGGCTTCGTTTAATCCGTCAAAGAATGCACCGGCTGGCGGGCGATCAGCTC
CGAAGCCTGCATTCAATGCACCTGCGCCGTCCTCTGGGCCAACGCCATTCAAGCCGCGCCACATGATTGAACGTTCCACAGGTCGCGGCAACTACATTCG
TAAGCGTCAGACGTACTGGGTGCCGCCGAAGCGCCGCCGaagcaacttcagcttggagaagaagcgaaaGGCTTTcatgaacgagcagcttgagATTAAG
GAGGAGCAACTCCGTCAGCAGGCTGCAGgtgccaacaacaagcaaAACCTGATTGTGCCTGGTGTGCAATGCTACATTCCTGACAAGGAGGAAGTGTGGT
TGCTGTCTGAGATCGTGGATTACAACGACCGCAAGAAAGAAGTGACCATCACGGCTTTCTTGGACTCGGGTGATTCGGAGCAGCGTGTTGTGGATCTCAA
GAAGCCAGAGGTCATTCGCGCAGTTGCTGGACCGACGGCTACCGAGGTGGAGTCACTTCCGGTTGCCATTCTTCATGACAACCCGGAGGGCGTGGAGGAC
ATGCGACTGCTTCGATACTTGAACGAGCCTTCGATTCTGTTCAACTTGAAACAGCGCTTTGTTGCCTCAAAGCCTTACACATACACTAATGACATTGTGA
TCGCAGTCAACCCGTACAAGTGGATTGAGAACCTCTACGGTGACCACCTGCACGACCAATACCTGCGGAAGGAGCGTGACTCGCTTCCTCCTCACGTGta
ctcgacgtcgacggcagcTTACAAGCACATGAAAACCAACGAGATGAATCAGAGTATCCTGGTGAGTGGCGAGTCTGGTGCTGGTAAGACGGAAACAACG
AAGATCGTGATGAACCACTTAGCCAGCGTGGCTGGTGGCCGCAAGGACAAGACCATTGCGAAGGTCATTGACGTGAACCCGCTTCTCGAGTCTTTCGGTA
ACGCCAAGACGACACGTAATGACAACAGTTCGCGTTTTGGTAAGTTTACGCAGCTGCAATTCGACGGTCGTGGTAAGCTGATCGGTGCAAAGTGTGAGAC
CTACTTGCTGGAGAAATCTCGTGTGGTATCAATAGCTGAGGGTGAGCGCAACTACCACATTTTCTATCAGCTTTTGGCTGGTCTGCCTAGTCGTGAGCGG
AAGGAGTTTGGTTTGGACCCTGACTGCAAGTACCAGTACGCCGGCTCACTTGCGGAGATGCAGATTCCCGGTCTTGACGACAGCAAATGGTTTGCTGGCA
CGCAAAAGTCGCTGTCCATCATTGGCCTCGATGCCGGTGCACAAAAGACGCTTTTCAAGATCCTGTCAggtgtgttgctgctgggtgaGGTGATGTTCGA
CAAGAGTGGTGAGAGCGGATCGCGCATTTCGAGTGGTTCTGCATTGTCACAAGTCGCCAAGATGTTCGGTCTTCCCACGACGAGAATCGAGGAAGCATTG
TGCAACCGCACGGTCATCACGCGCAATGATAGTGTGACGGTGCCGCTGGCTCCCATCGAAGCGGCGGAGAACCGTGATGCGTTGGCCAAGACCATTTACT
CTAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCCATCAGTACGGATGAAAGCCGCATTAAGGGCCAAATTGGTGTCCTGGATATCTTCGGTTT
TGAGGATTTTGTTCACAACGGCTTTGAACAGTTCTGCATCAACTACGCGAATGaaaagttgcagcagaagttcACGACGGATGTGTTCAAGACTGTCGAG
GACGAGTACATCCGCGAAGGCTTGCAGTGGGATCACATTCAATACCAGGACAACCAGGGCATCGTGGAGGTGATCGAAGGGAAGATGGGCATTATTGCCC
TGATGAACGACCATCTGCGTCAGCCGCGTGACACGGAAGAGGCTCTGGTCAACAAGATCCGCACGAACCATcagacgaagaagggtggcgacgtgaacga
gagTATTGACTTCCCCAAGGTGAAGCGCACGCAGTTCATTATCAACCACTACGCCGGTTCTGTCACATACGAGACGGTGGGCTTCATGGAGAAGCACCGC
GACACACTGCAGAAGGACCTGCTTGACTTGATCCAGCTGAGCAGTCTGTCGCTACTTCCGGAGCTCTTTGAAGACAGCGAGGCGACGTCGGAGGGCAGCG
GGCGTGGCAAGAAGCCCCCAAAGAGTCTTGGCACGCAGTTCAAGTCGTCATTGGCACAGCTGATGGACAACATCAAGACCACTAACACGCATTACGTGCG
CTGTATCAAGCCGAACTCAAACAAGAGCCCCACAGAGTTCAACAAGCGGATGATTGTTGAGCAATTGCGTTCGGCTGGTGTGATCGAAGCCATTCGTATT
ACTCGCTCAGGGTACCCGAGTCGTCTGACCCCGAAGGAACTCGCAACACGTTACGCCATCATGTTCCCCCCGTCCATGCACAGCAAGGACGTTCGCCGCA
CATGTAGTGCTTTCATGACGTCAATCGGCCGAAAGTCTCCACTCGAGTATCAGATGGGTAAGACGCTGATCTACTTCAAGAACGGTGTgatggaagagct
ggaagctaTGAAGTCCGACTTCATGTACTACGAGGCGCGCACCATCCAGCGTATTGTACTGGGCTTCCtggagcgccgccgcctgcgcAACAAGATCCGT
GCAGCCATCGTGCTGCAGTCCTACTCTCGCATGTCGCTCGATTTCAAGGAATATCACTTTCAACGCCGCGCGATCATCAAGATTCAACGTGGCTGGAGGA
GGTACAAGGAGGTCCCAGTTGAGCCCGTGTACGACGACCAGGAGTACAACGGCGGCGGTCAGTGGGtcgacgatgtcgatgacCTGGACGACTCGGATAC
CGACGAGGGCTTTGGCGACGACCCAGCTTCCATGCGTGCAGGCCGCGGCAGGTCGGTCGCGGACCGCATGGAGTCGTTCAAGGTGGCCCACTCGGGTCGC
CGCGGCAGCGTGAAGCGCCTCAATGAGCTGTCGGCTCGTGCCAAGAGCTTCATGAAGCCGCGTAGCGGAAGTGGCAGCACTTCGAGCTCTAGTGGCATTt
cgctggaggacgagaactcgatgctgaagatcgAGAACCGCAACCTGAAGTACGATCTTGAACTGATGCGCGAGCAATGCATCGAGCTGCAGGCCATCAT
CCTCGAGATCAACAAGAGCCGCAAGAGATAA