Transcript Name :
Pytve_DAOMBR484maker-pve_contig_131-fgenesh-gene-0.4
Orientation:
(-)
Number of Exons:
1
Description :
DNAJ
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
DnaJ domain1.2PR00625
DnaJ domain1.2PR00625
DnaJ domain1.2PR00625
Profile scan predictionP-Valprediction_id
DnaJ domain18.014PS50076
EF-hand domain10.413PS50222
HmmSmart predictionP-Valprediction_id
DnaJ domain1.9SM00271
EF-hand domain0.0096SM00054
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DnaJ domainIPR001623
*** None ***
InsideOutsideTMhelix
981-1017
1073-1429
1-957
1041-1049
958-980
1018-1040
1050-1072
*** None ***
PositionContextScore
475ANKRQIR|SA0.663
619DRIRVTR|TV0.633
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
Cluster Id
878
Sequence
        4290 bases(100 bases per row)
ATGGAGCTGTCGACGGTAGTTCAGCCGCCACATGGGGCCAAGACTGAGGCTCCCGCTCGACCCGCGTGGTGGTGGGCGGGCGACGCCGTGTCGGCGACCG
ACATTTCCGTCGCCACCAGCGAGACCGAGCTGCTGAGTGCTGCCGTGTTGTGCGCAGCGCTAGGCGCGACCAAGGCCGAAGTCACAGCGTCGGCCAGTGC
GGAGACGAAGGATCGAGCTGTCCGCGAGCTGTCGGCGCACGTTCGCAAGTCCCCGCTGCCGCACAACCTGCTCTTCCCCGTGCTCGAGTTCACGAACGAA
TATGTGATCATGGAGTCGGAGCTGGCGGTCATCTGCGCGATCCGCGCCACCAAGACGAGCGACATCCTTGAGGCCGTGGTGAACTCGGCGGTGCCAGTGT
CGCAGCCGTTTGTACATCGCTTTGGAGGCGCGAGAATCCACTCGCCGTTCTGGAAGCGAGCGCAGCGCTTGGAGCTTCAACCGCTGTATCGTCGAGCGCA
GCAGTTGAACAAGGTGCTCATCTTGTGCGGCCACTCGATGGCCGGCAGCATCGCACAGCTGGCGATGTGTGAGCTTGCGTTCCAGCGACTGCCGACGAAA
GTGAGGCTATTCCTCGAGCGCTTAGATTACGACGAACGCAAGAAGGGCAATACAGACAAGGAGAATGAAGCATCCGGCTCGTCGTCCGGCTCCGCACGAC
CCGAGCTCAGCGATTTGCAAGAATACCTAGCAGCCTGCGGTGACGAAGAACGAGTCCAGGTGATCCAAACGTTGCCTCGAGCCATGGCGATTGGTTTTGG
CGCTCCTTACATCGGCTCGTCTCGTCTCGCCTCGTTCTTGACGCCGCTCGGACTAGTGCCGCGAGTGACGAACTTTGTAAATGAGTTCGACTGTATCCCA
AGCATCTTGAATATTGCCCAATCGGCCGCAATGGTCGCCAAGACCACGGAACGTGCGTTGACGATCTCCAAGGCCACTGCGACGCTGCTCCGGATGCTTC
CGGCGCACATGCAGCAGCGGTTCGTGGGCCTTGCGTCGACAGCTGGAACAAGTGCGATGCCGACTGCGGCATCGGCTTATTTGTCAATGTCGCTGAGCAT
TCTCCAGAGTTCGTTCCGCAAGTTCCGTGAGTTCGACGTGGTGAAAGACATTGATTACCAGTACGTCCCAGTTGGCGCTTACATTTTCCTGTCAAAGAGC
GGTTCGAACTACCATATCTACTCTGATCCTGATTCCGTCGCGAAGGAGCTGACTCACGGGGATGAGTCGGCGACTTCATTGACTGGCAACACGATCCTGC
AGCACCTGATGAACGCGTACATGGACGCAGTCGCTCGGCGCTCGACGTCAATCCAGATCAATGCGACGATGAACTATTACGAGCGTTTGAGTATTCCCCG
AAACGCGAACAAGCGCCAGATCCGCAGTGCCTACAAGGCTTTGGCATTGAAGTGGCACCCTGATCGGTGGGCCAACGCGTCGGCGAATCCTCAAGAACAG
ACGACAGCCGAGGAAATCTTCAAGCTTTTGGCTGAGGCATACGAAGTTCTCGCCGATGATGGAGCGCGGAAAGATTATGATGCGCACTTGCAAGAATCCC
CGAGCCTCAAGGAAGAGTTCGTTCGTCAAGGCACTGTGAACGGGATGACGCTGGACGAAGCTATCGCCACGTTTCGCGACGCCATTGACAATTTGTCAGG
TGCTGTCTCCAAGGTCACCTCTCGCTTCAGCTCGTCAACGTCGACAGTCGTGCGCCGTCCGCTTCAAAGCGGCGGTGCGGCAACTTCGAGCCGCAATGGT
CTCGTTGCTAACAATCACGACAACATATTCATGCCTGACCGGATTCGAGTGACCCGGACGGTTGGTATTGGCGCCGACCAGCGCGATCAGGTTCTCTACT
TGGAACCTGAAGAGCTTCTGGCGGGAGATGTTGCGGCTCCCACTCAAGCTGTGCCGAATTCGAGCGCGAGCACAGGCTTGCGCACCATGTCTGTGGTTGG
CGGGGCTGTTGCTGTTGGCGCTAGTGTGGCGCTGATTGTGAGCGCATGGTCGCAATACACCGAGAACTCGAAGAAGAAGCACCAGGCGACCGTGGTCCGC
GATATGCCAGGAGAGTGCTTGCTTCTCTTGCTTGAGGATCATCGAAGCTCCAAGCAGTCGGTTGATCGCACTCAGCTGCTTCTACAGCAGGCGGCAGAAC
GACAAAGCAAGAAAGGCACTACGGTTAGCGACGGCTCTGGAGATGACGATAGCAAAACGAAGGCTGCTCTTGTGCGAGCTGCGCAGCAAGCCATCATCGA
GAAGAAGCAGCGCGAGGACAAGGAAGAAGAGGATCTTGTTGACGAGTTCTTCGATTGTGTCTCGGAGTTCGATCATGCGTCGATGGAGGCCCTCGCTGAA
GACGAGTTCTTTGACTGTGTCGATTTGATGGAGGAGATTTCAGTTCATTTTGGAGAAGTCACAACCGAAGACTGCGCTGATGTCCAGGCTTCGCAAGCTG
CCAACGGCGAGGCGATTGCATACCCGATTGGTTGTGCTGTGAAAACGCCGTTCGGGCTGGGGATCATGGAGAGTTGGCGCGATGGTGAGTCGTCAGCTGT
TGTGCGATTCAACGGGCCGCCGCCGTTCATGGTTGGTTATATTCAAAAGTCGGACATATCGCGCGGAGCAGCACTAGCTCGCAACGTTGCAAGCGAAGCT
GTCGAAGCCAAGCGCTCAGCGCTTGCCGACCGCGTGATTGTTCGCTATCAGCTCGAAGACCAGAATGCTGGCGGAACTGTGAAAGAACTCGTGACCGCAG
GTGCTGATGGAGCGCTTGACAGCGGCATCCGCGCGGCTGGCGGCGTGGCGTTAGCGAACGGAATGGCTCGGACGACCTCTGCGCTCGGAGGCGCTGTGGC
TGCTCCGTTGACCATCGCGTCGATTCTGGTGGACGTTGGGAAGGAGTACTATGACTACCGCAAGAAGCACGCGGACCGGAAACTGCTCGGTGTCTTGTCG
AGGACGAGCGAGGGACTGATGATGAAGGAGTTTCGGCTGCGGATGGGCGAAGTGATTGTGAGTCGCACGGCAGCGGCAGCTGGCGCTGGCATTGGAGCCT
ATGGAGTCGCCTCGGCGCTCGGGATGTGGACGACGGCAGGGATCGCGGGTGGCCCGGTTGGGATCGTCGCCGCTACCGGTGCGGCTGTTGTTGGCGGGAT
GTTGGGCTTCTTTGCGGGAACCAAGGCGTACACCGCATCGACCTCCTCGTATTTCACGAGCCAGCAGCATGCGAAAGAACATATCGATCGATTAGAGCTT
GGCGCGCGTCTTATGTTCGACGAGTATGATCCGAATGGGACTGGCGAGATCTCGAAGGATGATTGTGTCCGCATCATGACCAAGCTGTTCGAAGCCTCAG
GGTCGGTGTCAGAGAGCGGATACGAACGCACGCTGGCGGTTATTCAGGACGACGGGTTCGAAGGCCCTGTCACGTGGAGTATGTTCTGGGAGTGGGTGAG
TACGCAAGCCGCCCAGTCCTTGCGAAAGATGGAGCACGAAGAGTCCAAGAAGCTGACCGAGCCGATCGCTGGCGAGACGTGGTGGGCGAGCTACATGACG
TATTTTTCGTATGGGAAGTCGGCTCTAGAGGAACCGGCCCGTTCGACATTCGAGACAATCGGGACGGCTTCTATGGTCACGGCAACCATGTATCCCGGTG
TGCGGTCGACGCTCAAGTTGGTTGGTGCGGAGCCGCTTGCTCTTCCTGACACGAGTCAAGTCGGTCCAGCCGCAAAAACCGACGACCAAGAGAACCTGGT
CATCTTGAAAGCGCAAATGGAGTACCTGGTCAACGCGGGCTATCTCACTTCGGATGACGCGTACCAGCTGCGCGACCAACTGGAATCGGACGATGATGAA
GTGCGCGAATCGGCCCGCAAGACGATTCTAGCCATGCATGCGGGGCTCGCCGATGTCGAGGCTGCTGGTGGGATCGTGTGCGACGGTTTTGGGTTCGACG
GAGGTGACGAGCCTAATGGCGACAAGGAGGACAAGGCGGGTGTGCCAAACAGCGAGGACTCCAGCAAATCTTCCACCTCGCCGTCGACGGGGGTCAAGGG
GTCGAAGGACGTCGCTACCGACGAGAGGCTGGACGTTATGTGTTCCATGATGTCAACGCAAGGCTTGCAACGGTTCCTGCAGTCGCAGAACATTCCCGTG
ACGTCCAACAGTGGGAAAGCGCTCGAGCACTCCGAGCTGCACTGCTTGGCACTCGAGAACAGCGCTCCAACCCCTGCTAAACGTCAGTGA