Transcript Name :
Pytve_DAOMBR484maker-pve_contig_103-snap-gene-0.19
Orientation:
(+)
Number of Exons:
4
Description :
Transcription factor
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-535
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4223
Sequence
        1825 bases(100 bases per row)
ATGCAGCCCGTGCAGGACCCGTCGGCCGCTGGCGCCGACGCCGCGCAGGCCTTCAACTACGAGTCCTACCAGCAGTATGCGCACGAGCGCAGCGTCCACG
ACCAGGCCATCCACTCCATGACCGCAGCCGTCGGCTNNNNNNNNNNTCGCACGAGGGCTGCGACAAGGCTGCGCAGTCGAACTTCCTGTGCAAGGCGCAC
GGCGGCGGCCCGCGCTGCCAGTACCCGAACTGCACGCGCAGCTCGCAGGGCGGCGGCTACTGCCGTTCGCACGGCGGCNNNNNNNNNNCGCCAGTACCAC
TGCTAGTGGTGGGGGGCCGACCCGTCCCAAGCTGTCCACGAACGCGTCGGCCCCGACGACCAACTCGTCCGCGCCATCCTCGACATCGTCGTCCCCGGCC
AAGAAGACCAGTACGGCGGCCTCGTCCTCGGCATCGAACGCGAATGGGACCAGCACGAGTACCGTGAATTCCGCCAGCCGCAACGAGTCGCTCAAGTCCA
ACAGGCTGTGCACTATGCCCGGCTGCAAGAAGCGTGTGCGATCCAAGGGACTATGCAAGGCGCACGGCGGCGGACGCCGCTGCATGGTGGACGGCTGCGA
GCGGTCGTCGCAGGGCCAGGGCCTGTGCATCCGCCACGGCGGCGGCAAGCGGTGCACGCAGCCCGGCTGCACCAAGGCCTCGCAGAGCAACGGCCTGTGC
AAGGCCCACGGCGGTGGGCTCCGTTGCCAGGCCCCCGGATGCACCAAGTCGTCGCAGGGCGGCGGGTTCTGCCGCGCACACGGCGGCGGCCAGCGGTGCG
AGAAGGAGGGATGCAACAAGGGGGCCCAGCGCGGCGGTTTCTGCGCGGGTCATGGCGGCTCGCGGTTCTGCCAGCACCCGGACTGCACCAAGAACGACCG
CGGGGGCGGCTTCTGCGCCGAACACGGCGGCGGCAAGCGATGCGACCACCCGAGCTGCAACAAGCCCGCGCGCAAGAAGGGCAAGTGCTCCTACCACGCG
AACGCCTTGAAGGGCAAGGCCCCCAAGGACGCACTGGCCGGATCCTCGGCTGGGTCTGCTGCTGCAGCGGCTGCGGCTGCTGCAGCGGCCGCTGCGGGCG
TCTCGGGGGTTAATGGCGGCCTCCCGCCGCACATCATGGACATGCGGCAGCTCACGACCCCGTCGGCGTACGCGCAGATGGCCAAGGACCTGCGCGGCGA
CCCGGCGGCCGCGAGCCACGTCGGAATGGACCACCGCGCGATGCCTGCCGCGTACCAGCGCGTCGAGTCGATGGACCAGCGGTACGGCGCGTCTGCGGCC
ATGAAGGCGTACGACTCGGCCAGCCAGGGCCCCCCGCCGCCCTCGGCCTCGTATCTGTCGCTGCACACGGACCAGCGGTCGTACGAGCCGCTGGGACTGC
AGCCTGGCGCGGGTCAGTCTCGCCATTACGGCCTGGCGATGGACTCGTCGGCACTGCCGCCTGTATCAAGCGGCTACAAGATGGACCGCGCGCCAACGGC
GGCGTACGGCGCGGCCGTGCGCGGTGACTACGCCAAGTCGGCCGGCGTGAACCCGTACACACAGCAGTGGTCGAAGGAGATGCACCCGGACGCGCGCGAC
TACTTTGACATGAAGGAGCAGCAGCAGTCGCAGCAGCAGCAGCAGTACGCGTCGTCGCAGTACCACCACCACCTCGCGGACTCGGCTGCGGCCTACGGCG
GCCACGCGGCGGCCCAGCCGCGGGGCANNNNNNNNNNNNNNNNNNNNNNTACTACCACCCGGTCCAGGGCCAGCAGTCGGAGCAGGCGCCGCCCGCGGGC
TCGCAGACCCAGCCGCCCAACATGA