Transcript Name :
Pytve_DAOMBR484maker-pve_contig_67-snap-gene-0.30
Orientation:
(+)
Number of Exons:
6
Description :
GA18394
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1601
*** None ***
PositionContextScore
65PIARTAR|SL0.625
646FPSRSFR|SF0.621
*** None ***
GO
*** None ***
*** None ***
Cluster Id
852
Sequence
        5109 bases(100 bases per row)
ATGGCGGCGCTGCAGGAGGCCAAGTTCGCGTGCTTTGACGACGGGGAGCTCGCAGGGGCCGAGGTCTCGCTGACGGGGTCTGGCTCGGAGAGCTCCAGTC
TCCCGGTCTTCGCTATTGCCTTCCCGCCAGGCGTGCGCAGTCAGTCGCCCAAGAGCTTCGCGCGCGGTACGAATCCGATCGCTAGAACTGGTATAACCTC
CCTTTTCGGCTAACGATCGTTGTTCATAGCGCGGTCGCTCGAGTGTACAGGCTCCGGGAGCTTCTACTTCCAGAACGAGGCGCTCAAGGACCGCTTCGTG
TGGTGCGTTTGCTGCTAAAAGGCGATCTGGACGGCTCGTACACAGTTGCTGACACTGTTTTTGAAGCTGGCGGGTCATCAACAACGTCGTGGTGCTGCGC
GAGTGGAGCCTGCACGTCTCACTGGCTCACAACGGCGTGCGTTTCGAGTTTCCGGGTGGGTCTTAGCCTCAAGTTCATTTCAAAATGCCAAAATCCTGAC
CGACCTCATGTTATTCATGTGCAGCTCCGGTCGTGGCCACTGGTGTGTACGCCGTCGAGTCGTGGGAAGACAACAGCGTCACGGTCAGCATCGTGACCCA
CGCCGGGACGATCCACCGCTTTGCCTACCCTGTCCCAAGCGATGTGAATCAAAGTATCTTTTCGCATGCTGACCCGAATGCCTTCCCGGCCAAGCCCACG
ACGAGTGTCAAGTGCGACGTGATCGGAAGTCTGGCGGCCGATGAGATCATCTCGGTCGCGCTCTGGGTCAACGAGTTCAACTTGACGCTCGGCACGGACT
CGGGTCGCGTGGTCGGTGTCAACTTCGGACTCCCGACAGCGACTTCTTCTGGCGGCGAGGTGCAGGAGTTCGCGTTCTCGGACGAGTCGATGGTCAAGTG
GCTCTGGCAAGGGTTTCTCAGAGCTCGCCATAGCGATGATGGTCGCCGTGCTGGCAGTTCATCCATCATAGCGATGACGTGCTTCCCGATGGAGAGCGAG
GATGAGAGCGAGGAGAATGACGTGTGTCTGGTGACCATCTCGGCGGACTGCGAGCTGCGTGCGTGGTCTTACAGCAGCCAGTCGTGCCTCGGTAAGCAGC
AGCTTAGCACGATCGCCAATGACCCGACTGGACAAAGCGGCAGTCCGGACGCTTTTGCGAGCCACGCCAAGGTTGTTGCCCTGCCATCGTCAGCGACCGG
GAACTGCCGACTCTTGGTGCACCTCGACACGACCGGCGGGTATTCGCAGGAGATCTTTTTGCTTCGCGGCGACATCTCGCCATCGCCAACTGGGAGCCAA
GTAGATCTGGATTTGGACGTCGCTCGGGTGTTCTCTGTTCGCTCGCAAGAATCGATCGAGACGAAGCGCCTCAAGATGGTGGACTTTGCAGTCGACAAGA
ACCACCTGTTCTCGGCGTGGCGCTCTTCAGAGGGAGACATTGTGTACTGCCACCCGAATCCGATGGCTCTGACGGGTCCGAAGTTGATCCAGGGCGAATC
GATCAGCAGCTTGGACGACCAAATGTTGAACTTCCAAGACGACGATGGCGACTGGCCGTTCGATCTCAAGGACGAAGACGCCATTGCTCGCATTGATGTA
AGTTTCTTTCACGACGTTGCTCACGGACTACAGCTGACAACTTTTTTTTCTGTGGTGTAGGACTTCTTTTGCGAGCGCGTGCTCCTTCCTGGCCGGTTCT
CTCGACACAACCTGTACATGGCTGCTGTCGAGTACGTCGGCGCTGCAAACTTCTCGCTGCGGCCGCTGTTTTCGCAGCTCGGCCACCAGCGGTCCAAGTA
CAAGGACCTGTTGGTTCGGATAGTGTCTGACAAATGGATCGAGGCTGTCAACCGTAACGGCGGCGCGGCATCTCGAAGCCCGACAGAACCCAGCATCATT
CGCATCGAGATTTGGAAGACTGTCTTGGATCTGTGCACCAAGGTAAGGAACGAGCTGTGTCTAGATCTCCATTCTGTCGACTGTGTTGTCTGATTCGTCT
GTCTCGACAGCACTGGCGAACGGAGAATGTGCCAATCGGCTTCGCGACAACTACCAACTCGCTGCTTCCCGGCTCGCCTGTGCTGCTACGACGCAACCGC
GTGTCATTGTTGTTCCCTTCGTCTCCCACGATCACGACGGCTTTCCTTCCGCAAGGCAGATCCCCCGGCGCCGAATGCGTTCGCGATGTGATTGCTCAGG
TGCTGCCAGCGTTTGACGCCTTCCCCAGCCGGAGCTTCCGGTCATTTGTGCACCGCGAAGTCGCCGATATCGTGTCCGAGTGGAAGGTCGAGTCGTTTGT
GACACTCGCGCGGCACTGTGTTCGTCTCGGTCTGCGCGGCGGCTTTACCACACCGAACGGACGAACGAACAACGACGGCATCGCCCCGGAGATCCAGCTG
ACTCGAGCGATCTTGCAGCTGAGCAAGATTGTTGGGACAGATTCCGACTTTCACGAGCGCGTGTTTGAAGATCTGGTTGCGCATTTGTTTCCTTTCGAGC
TGTGGAAGGGATCGGGGTCATTTCGACCCGCGTCGCCGGTGCGGGCTGATGCTGTCGAAGACGACGAGGACGATGACGAGGATATCGCGATGACAGATGG
TGCAGCCGGGGACGATTTGTACACGCGGCGGTCATTTTTCTGCGGCAACGAAATCTGCTTTGCCTTCGACCAGGTCGCGTCTCGGACAATCGACGAGATG
TGTCACCAGGGACTGCGTGTGATTCTGTTGCTGTCATACTTGGTGGACTCGCGGCCGTCGTTCGTCGAATCCTCGGTGTTGAAGAAGATCCTCCAAGTGC
ACTTGCCGCGGGCCATCATGATCTACCAGCGGTGGGAGCTGAGTCGCTGGATCGCTAGCCAGAACATCACGCACGCCACGGAGCTGGACTCGGCAGTTTC
CAAGGCGTCAGCGACGCTCCTGCCGCCGCTCCTTCAGCTCTTCCTTCGCGATGTGAACACTCGCGTGAACCGCTCGACGGAGTTCAAGCGCGCGCTCTCA
GTGTTGCAGGCCGCACTCCTGAGCGATAACGTCGAGAGCGAGCAAGCCCAGAATGTGCTCTCCACGTTCACGCGCGAGGTCTTGCGCTATGTGTCTCAGC
CAAACGAGTCGCTCGTGCGTTTCCTGCAGAAGCGAAAGCAGTACAAGCTGCTTCGCGCCATGTTCTGCTGCAATCTGAGCGATGTGAGCCTGCAGAGTGG
CGGCATCAAGCATGAAGACGGAGGCGACGCGATCAACCGACCGATGCATCAGTACGTTCGATCAATCGGCGAGTGTTTGGCGTGTGAAGGACAAGCGGCT
GCTCGAGCTGACGACAAGAACCACGCCGACTGGTGCTTCCAGCAGGCGATCCGGTGCTTCAGCATCTGTCTCTCGTCCTTCTACTCGGACAGGTATGAGT
TCGCGAACACGAACGACGACAGCAATCGTCAGTCCGCTGAGCGGTTCATCTACGAGGTCGTCGGTGTGCTGAAGCAGACGGTTCCACGCGGGTTCTTTGA
CCAGATGCTTGGGTTCCTTTGGACTGTCGTCACCCAAGCTTTCAACCGCGCTGTCGAGTCGGACACGGCTCTGCAGTCTTTCGTGTGGGTCAACCTGTTC
AAGTACTCTGTCGAGGAGCAGCTCTTCCGGGACGCTCACCTCGCGCTCACGCACATTATGGAGTTGGCAGCCAACGACGGCGACGAGTCGGCGTCCATGA
AGATTGACAATGACGAATGGCACGGCGCTGAATCTACCGATATGAACACTGCGGGCGAGTGCGCGAGCTACTTGGTCAAGGAGCTGTGTCGATACAACCG
ACTGGACCTCGTGAGCGACTTCCAGTGGGGAGCCATCGAGAGCGACGTCGAGAAGCAGTTGCAGTGGCAGGCGGCCAACGCCAACGTGGTTGCTGCGGGC
GGTGCGCTGGACCGCAGCGTCGTCATGCACTACAACCTGCTCTTCGCCTTCTACTCTCGGCGGCAGCAGCCCGCGAACGCGGCGACGGCGCTGTACTCGC
TCGCGTTGCGGCTCCGACTTGCGCGCACCAAGTCTGCTGAGGCGTTGACGGCGCAGCGGGACGCACTAAACACGGCGATCATCGCTCTCCAGTCGTTGCC
GACGCAGAGCCGCTGGATCGTGCGCAAGTTCCACACTGAAGAGCTGATCGGCTCGGTCGCCGCAATCGAGCAAGCCAAGGGATCGGCCTCCAATCCAGCG
CTAAATGTCGTGACGCTGGATGATGTGCGGCGCGAAATCGCCGTGTTGGACGGCAAGCTTCGACTGCTGCGCGTGGGCCACATCGAGAGTGAGCTGCTCA
ACAGTATGACGGAAGACGAGGTCGTAGCGCTGCTGGTCGACTCGGTGCAGACGTGTGCGAGCGATGGGTGGGCTGGCACCCTTGCTGAGAAGCGGCATGC
GGGAACTGTCGCTGTCGAACTCGCTGTCGACATTGCTCGCCGCAGCAGTTCGAGCTCGACCAAGGTGCTGTCCAACATCACCAAGTCGCTGGCGCGCTAC
TGCGTGGCGAACGAGTACTCGAGCTCCGCGTCTCGAGAGAGCTGCGACCTGTGTTGGGAGATGCTCCAGCTCTTCCTGAGCGCTGTCGAGTCACTGCCGC
AGTACGAGCTGGCGGTCGCTACTATCCTTGACTGGGAGATCCAGCCTGTCGTCCCTCGATGGCTCTACGACCGCGTGGCCCACCCGGTTCGCGGCAACCC
GGCCAAGTTTCTCATGCTGTACCTGCAGCGCGGACTGCTGCTCGAGGCGCTTCAACTCGCCGAAGAGAGCATCTCGTCTGACGTGATGAGCGAGAACGAG
GCGAGCTTCCAGAAGCGCGCGGCTGACTCCAGGTCGGCTCTGCCATGGGTGCCTTACAACGTGCTGGATGCGGTGCTGGAGGCCGCGCAGTTCGCGCTCA
CCAGCGGACAGCATCACGACCAAGAGCTGCTAGACCAAGTGCGACAGCGCGACCAGCGAGTCCGCGCCAAGCTGAGCGAGTACTTTGAGTTTGTATCGGT
GCTCGAGCAGGCTCGGACAGCCGCGGGCGTCGCGCAGGACGTGGCACTGCTAACGGCCGGGCCGACAGGCAGCGGCGCTGCGATCAGCAGCAGGCTCTTC
CAGCTTTAA