Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.17
Orientation:
(-)
Number of Exons:
3
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-552
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1792 bases(100 bases per row)
ATGGATATGAATGTGAACATTGTGGCAGAGCGCCATGCATTCGGTGAGCGTGTCGCAGTCACGAAGGGCGGCTTGCGAACCCGAACCGTCGTCAACGTCT
ACGACGGCACATCCATCGAAGTGGCCTACAACACAAAGGTGACAGCTCAGGTGAACGGGAGAGTGACAACGACCAAGCCTAATGGGACAGTGATTGTTGC
CAAGGATAGCGGCCGCGTAGAGTACTCTTCCGCACAGTCACTTGGCCTCTGCAGCGGCTCTCCTCTTCCCCAGTTGTCGGAAGAAGACAAGGATCGCGAT
GTGATCAGTCACAATGGCGTGTATTACTTTGACTGTCGTCTCGGACGCTTTGAGCTCTGCGACAATGAGCAGAACACCTTTTTGGTAGAGATTGGAGACC
GATCGACGACACCTCGAGCGTCGGTCGATCTTGCCGGTGAGGTGAGCGCGGCCGAGTCCGAAAAGTATCAAGTTGACCGGATCCCTGCAGCGGCCACGAT
CAACGATCCCATCCAGCCCCACGTGTTCATCTTGAACGGCGACGGAACAGCTCTCGAAATCATGCGACCTCGCGAAGTTTCCGAGTTCCTCGACGCCAAC
AAGGGTGATAAAGGGTCGTTCGGGATCTCCAACCCGCAGAACCCTGTTGGTTTCCTGGAGAATCGCTTGTTTTGGCGTCCGTGCACTTTGAACAAGCGCA
TGCCAATCTTCAATAATGCTAACTTGGAGATCGAATTGGCGCGCCTAAGGAAGCCTGTTGCTACGGTCGGGAAGTATCTTCAAGATTACTACGCCGAGTT
CAGCTCTCGCTCGAATCGCCGACAGTTTACAGTGGTCCGTCGACTGCTGGCGCTCCAGCCACTGTCAGCGCCATTCGTTGAGAAGATGCAGGAGGCCTGG
CAAGCCTGGCGACGATGGCAGGAGGAGCGGTCGGCCAACAAGGATCGTTTCAAGGTAGTGGACCCGCGAGATCATGATGCACTGGCTCGAGAAGTAGCCA
TGCAGAAGCGCGTCTTGGCGACCTACAAGGCAGCTCGGGCTCGCAAGAAACTGGAGCGGCAGAAGGCGCGCGAACAGCGGTTGGCCGATGCCGCCAACAA
GAGTGCGCTCATGGAAAGTGTGCCGGAAGGCAACGAGTCAGCCAATGCTGAAGACGCTGGACCCGCCGGAGAAAGTCATAGCGGCGACCTGGATGAAGAC
GACGACTTCGACCAGTATGGGTCTGAGACGAGCAACGATGGTTCCTGCGATGGCGCTGCGAACGACGTCGACGATCCCATGGCTCTGTTGTGGACAGCGT
TCTCACACACCGACACGACTGGTGGCGGTCTGCTCTCGCTGCCGCAAGGTGCGTTGTCACTATTGTTTTGTCTATGGTTGCTGGACGTTGAAGGCAACCG
CAACTCCTAACCCTTGTGGTCGCGCCGAACAGCGCGCCAAGCGATCATTCAAGCACTAGGGACTGGAGTGACCTCCAGCGAGCTTGCCACCGTGCTGCAA
CAACGCTTCCGACTGACCCAGCCATTCGCGGTGCGTTCCATTGACACCAACGTGCTCGTCGACGGTTTTGGCTCAGCAGGTTTCGCTGTCGCAGGTGAGC
TTCGACCTGTTTGTCGATCTGGTCGAACACTTCAAGCGGTGCTATGGCGACGCCGATGGAGACAGCACCCATGCCGCTGGATCTGGCAGCGTCCCGCCTC
TACACGCGTCGTCTGCACTCCGGATCGGGCAGCGGCAGCACATTGCGCCGCCTCCAGCGGGCTCGGCAGCCGAAGCCGTGCAGCGCCGTTAG