Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.10
Orientation:
(+)
Number of Exons:
3
Description :
AmphiHMG1/2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
High mobility group box domain6.5PR00886
High mobility group box domain6.5PR00886
High mobility group box domain6.5PR00886
High mobility group box domain6.5PR00886
Profile scan predictionP-Valprediction_id
High mobility group box domain19.096PS50118
High mobility group box domain18.727PS50118
HmmSmart predictionP-Valprediction_id
High mobility group box domain2.5SM00398
High mobility group box domain3.2SM00398
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
High mobility group box domainIPR009071
*** None ***
InsideOutsideTMhelix
1-213
NN-scoreoddsWeighted Score
0.8434.7070.009
*** None ***
TypeScore
nuclear783
GO
*** None ***
KO ID
K10802
Cluster Id
3922
Sequence
        782 bases(100 bases per row)
ATGGCGCGCGGAGTCGGACGCCCCAAGAAGACGGACGCGGGTGGAGCCCCGGTGCGCAAGCAGCGCCGCAAGAAGGACAAGAACGCGCCGAAGCGCGCGC
TGTCGGCGTTCATGTTCTTCAGCAACGACATCCGCGAGACGGTGAAGCGCGAGATGCCGGAGCTGGAGTTCCTGCAGATCTCGATGGAGATCGGGCGTCG
CTGGAAGGAGATCACGGGCGAGGACCGCAAGGTGTGTTGGTGACTGTGGTGTTGCTATATTGATGGTGGTGTCATTATGCTGACCTTGCTGTGTTGTTTC
AGCCGTACGAGGAGCTGGCCGCCGCGGACAAGCGCCGTTACCAGGAGGAGAAGGAGGACTACGTCCCGGACCCGTCGTTTGAGGTGCGTGGTTGGTTGTG
CTTGTTGATTGTGGGTAGAGTGCAGTGTGCTGATGTGTGTTGACGACTGCAGGCTTCCAAGTCGAGCCGCAAGAAGAAGGACCCCCTGGCGCCGAAGCGC
GCGCTGTCGGCGTACTTCTTCTACTGCAACGAGATCCGCGCGGGCGTGCGTGCGGAGAACCCGAACAAGAAGATCACGGAGATCGCGACGCTGCTCGCGG
AGAAGTGGCGCGCGCTGCCGGACAAGAAGCGCGCCAAGTACCAGAAGATGCACGAGGAGGACAAGGTGCGGTACCAGCGTGAGATGGACGCGTACAACAG
CGGCAAGAGCCTCGCCCACCACGAGGAGGAGCACGACGAGGAGGACGAGGAGGAGGACGATGACGACGATGACGACGAGTAA