Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.32
Orientation:
(+)
Number of Exons:
7
Description :
Ganglioside-induced differentiation-associated-protein 2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Macro domain9.943PS51154
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Macro domainIPR002589
*** None ***
InsideOutsideTMhelix
1-634
NN-scoreoddsWeighted Score
0.5421.2110.002
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        2289 bases(100 bases per row)
ATGGGCGAGCCGGCCATCTCGCTTGACGCGCTCGCACTGTGGGGAGCAGGCCGCGACGACGACGCCACGGACTCTGCAGATGCTGTGAATGCCTCTGTGT
CCACCAGCGACAGCCGCGCGCCGGTGCTGCTCGACCGCGAGCTGAACAGCAAGCTGTCGCTGTGGCACGGCGCCATCCACCGCCTCGACGTCGACGCCGT
CGTCAACGCCACGAACGAGTCGCTGCGAGACAGGTCTGGCGCGTGCGGACTGCTGCTGGCGGCCGCGGGACCGCAGATCTACGTCGAGTGCGATGCGGCG
GGGCCGTGCAGGACGGCCGAGGCCGTGGCGACCCGNNNNNNNNNNCGTGATCCACACGGTCGGTCCCAAGTACAGCGCCAAGTACCGCACGGCGGCTGAG
CACGCGCTGCACTCGAGCTACCGCAGTGTGCTGGCGAAGGCCAAGCAGCTCGGCGCGCGGACGGTGGCGGTCGGCTGCGTNNNNNNNNNNNNNNNNTCCG
CAAGGGGTATCCTCGCGTCGAGGCGGCCCACATCGCCGCTCGTAGGTCGGCTTCTTCTCGGTTGGTGAATGCTGCAGGTTGCTGACCTTCGGTGCATGAC
GACAGGCACGATTCGCCGCTTCCTCGAGCACTACAGCGCCGATTTCGACCGCGTCGTGATCGCCGTCGACGCGCTGGACGACCAGACCATCTACGAGGCC
GTGCTGCCGCTCTACTTTCCTCGCTCGCTGACCGAGCAGGAGCAGAGCGAGCGCGACCTCGCCGACCGCGACCTCGGTAAATCGGACCGTTCCCTTCTCG
TCCTGATAGTGTAGCATATGGCTCACCTCGTGGACACCGCAGGCAACGAGTTCGGCGAGCCGGTGATCCCCGAGCGACAGATCCGCATCGGTTCGCTGTT
TGACAACCAGAGTGAACCCGACGACTCGCGTACGTCTCACTACAAGGCTCAGCGCGTTATGTGTGTTCTTGACTCACTCTTACTGGAACTGCAGCGTCCG
AGGACGAGGACGAGGCCATTCACGACTTCCGCGCCATGTCGATCGACCCGGACGCCGAGCGTGTCGAAAGGCTGCGGCGAGCGCAGGAGGATCGGCAGCG
TCGCGCGCAAACGGCTCTAGCCGAGGCGGAGCGTAAACGCAGCAAGAACGCGGCGATGGCGCTGGACGACGAGGCGGCGCTGGCTCGGAAGAGCGACTTC
ACCGACCTGCAGGCGCTCGACTTCCTCTTCCCGGGAGGCGTCGACCTATCCGGCGCGCCGGTGCTCGTCTACCTCGCGGCCAACCTGCCGCTGGACGCCG
TCGACCTGCGCCGCGTCGAGGTCTTCGCGCTGCACTCGCTGCAGACGCTGGCGGCCAAGTGCGAGAGCTTCAGTATCGTGGTGGTGCCGAACGACGACGG
CCAGCAGGCGGCAGCCGCGTGGCTTTCGCGTCTGCTGCACGTGTTCGGCGCCGCGCGCCACCAGAACGCACTGCGCTTCTGCTACGTGGTCGAGCCGACC
GTGTGGCTCAAGCTGCTCGTGCTCGTGGCCAAGCGGTCGCTGAGCGGCGCCTTCTACCGCAAGATCGTATACCTGTCGTCGTCCCGCGAGCTCGACAACA
TCGCGCCAGACATTCGCCTTCCCGAGACCATCTACTCGTGAGTATCAGTCGATACGATTGTGGAGCGATAGGAGGAGGAGATAGAGGTCTTGACTGACGT
GTGGTTGCTGGTGCAGCAAGCGAATGAGCGACGCGCCAGAAGACAACCAGGAGGAGGCGACCCCCGATGCAGCGACGGTTGCAGACGGCGACGACAACAA
CCATGAGGGAAGCGACGAGGCCTTCGTCTAGCCGTCCGTGTCTAGTATTTAGGTGTGTAGCTTCAGGTCCTGCTCGGAATGCCAAGCTAGTCAGTCGAGA
CTTCTTTCATTCGATACAGCGGCAGCACCTCATTCCCGCTTCGACGCGTTCTGGATCAGCACCACCGACTGCGCGTCCGAGCCGGCGACCACCGTGTCGC
TCTCGGCGTGGACGGCCAGTGCGTTCCACGGCAGATCGCTCTTCGCCACGGTCTCCACGCGCAGTCCGTCGTCGCCGTGACCGCCGAACCCGTTCGCAGT
CGACAGCGCGAGACCGGCGCTCGACCGGCGCTCGTACTCGACAGCGTCCCGGTCGCGCCGCTCGTGATGGAAGTCCCAGCGACGCACGACGGCGTCGTCG
CCCGCCGAGAAGAGGAACCGCGGCGACGCTGCGTGCAGCTTGACAGCGCGGACTGCGGCAACACCAGCATTGTCAGGCGAATAGTCTGA