Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.12
Orientation:
(+)
Number of Exons:
1
Description :
Phospholipase D; Pi-TM-PLD
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phospholipase D/Transphosphatidylase9.035PS50035
Phospholipase D/Transphosphatidylase8.782PS50035
HmmSmart predictionP-Valprediction_id
Phospholipase D/Transphosphatidylase19SM00155
Phospholipase D/Transphosphatidylase6.3SM00155
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
36-55
105-112
175-180
246-257
308-813
1-12
79-81
133-151
204-222
281-284
13-35
56-78
82-104
113-132
152-174
181-203
223-245
258-280
285-307
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
catalytic activityGO:0003824IEA
metabolic processGO:0008152IEA
*** None ***
*** None ***
Sequence
        2523 bases(100 bases per row)
TGGGCGGTGGGTCTCAGTATCGCCGTCTCTCTCGCGTGGCTGCTGGTGCTGGTCGCGGCGCAACGCTTCTCGCTCAACCAGATGCACAACCCCTTGGTGC
CGACCCCAAGCGCCTCGTTCTACCTGTATGCCGGCGTGTTCAACTCGCTGCTCGGGAGCTTCCTGTCTGCGAGCGGCTATTGCTGCCAGAAGGTGGCGCA
CAACCGCGTGCAGCACCACCCGGCGCTGGGAACCGCCTCGCAGCAGCCCGTTTTCATCGCCGGACTGTTCGTGCTGGCTGTGGGCACCATCTCGGCCGTC
GTCAATCTGGGCATCCTCGGTCAAGCCGTGCAGGCGCCATTTGCGGCGCTCACCCTCATCTACAGCGCGCTGCTGGGCCGCGTCGTGCTCGGCGAGCCGC
TCGTGACCGTCGACATATTCTCGAGCGTGCTCATCGTGCTGGGCGTTGCTGTCGATGTGCTGGCCGCGCGACTCGCAGATGTTCCTTCCCGCTCGTACAA
CCTGAAGGCGCTCGCGCATCTGTTATTCCGCGACTCGCCCTATCCGACAGCCTACACCATCATTACGCTAGCGTACACGACGATGATTCTGCGGCGCGTG
TACTCCAGTAAGCTGCATCGACGCGCGGTGGGGCTGCTCGCGTTCTCGTCGTGCGCGGGTATCATGGCAGGCTTCACGTCGCTCGCTACCAAGTCGGCAG
TCGAGGTTGCCAAGGCCGCTCTCCACGAGGGCACGTGGCTGTATCTGATGAACCCGTTCTTCGTGCTGATACTGCTTGCCGTTCCTGCCGCGCTCATCCC
GCAGCTCTATTTCCTGAATCAAGGACTCGAGTTCTTCGGCACGCTCAAGTTCGTGCCGCTCTACCAAGCCTTCATTATCCTTGGCAACATGGGCTGTGGC
ATGGTCTTCTACAACGAGATGGCCAGCTACAGCGCGGTTCCGCTCGTGTGCTTCGCCGCTGGCATTGGCGTCACACTCAGCGGTGTGTGCCTATTGCTCG
TCAAGGTTGATGCTCACCGCGTTAACATCAACGCCGTCGATCGGTTGGCCACACCGACAATCAGTGTCACCGCCGGCGGCGATTTATCACTTGTGACTGA
CTTCTCTTTCGCTGACATGGCGTTCGCAACCGACAACGTGGCGCCGCTCCGCGACTTTGACGAATGCAAGCGCGCGATCGTGCAGCTGCTACGCTCAGCG
CGCACGTCCATCTACTACTCGACGTTCCTCTGCGACTTTAGCCAGGACTTGACTGTGGATGGAGACCCTGACGAGACCGAAAAGCCGACGATTGCATCTC
TGATTGCGGCGGCAGTCAAGCGAGGAGTGCGCGTGCACGTGCTGTACAATCCGGTGGTCGACTATGGCACGGCCACAGCGCAGGAAGTGAGGCGGCAGCT
GCCGCGTGGCGTGGAGCTCGCGTGTTCGGTCAGCGACATGGGTCCGAGCGTCTTCACGCGGTGCGTCTCCAACAACTCCAAGTACGCGTTCCACCACCAG
AAGTACTTGTGTGTGGACGAGGAAACCATCATGGTCACAGGCTGCGACGTCAACACGGAGCGCGCGGGCTGGCTGCGCGCGAACCACTTCGGCTACTTCT
GGCACGAGTTGGGCGTCGTCGCGCCGTGCTCGCCGGCCATGTTCCGCTGGATCCGAAGCAACCACGCGGCAGCTCCAGTGAAGCGCCACTATGACCAGTT
CATTGACTCGCCGCCGTTTCCGCTTGTTGCCGGTGGGTGGCGTGAAGAGAACGCCATGGTCAACCTCATCCTGAACGCGCAGAAGTCGGTTCAGCTCGAG
AACCAAATCCTCATCTCGGGTGGATCGCTCCAGCATAACCGCATCTGCACGGCGCTCGTGACTCGCATCGCCGCCGCGCACCGTCGAGGCGAGCACTTCC
ACGTTCTATTGCTCACGAATGCGGCGCAGCAGGACGAACCCTCGCAAGTCACACGCTGGTACTGCGCGCTTTCGATCCAGTGGTCGCTCGAGCAGCTTGA
GGTGTGCGCTGCCTCGCTCGGGATGACTCATCGCGATTTAGCGAGGCACGTGATCGTCGGCCGTCTGGCGAAAGACGGCGTGCTCATCAAGGTGCACTCG
AACATTCTGATCGTTGACGGCTGGTACGCGCTGCGGTCTTCGTCCAACCTCGCGGACCGCAGTCTGAGCGCAAGACCGAACGACACCGAACTCGGGCTGC
TGTTCGCCGGTCCTCGTGTCGCTCAGCTCCAGCAGGATCTGTTCAACATGTACCTCTCGACCTCTGGCGCGAGCTACTCGATGGAAGACGTGTTCCACCG
TGTTGGAACCGAGGGCGGAGATCCCGCGTGCTGCATTGTGCCGCTCGAGAAGATGACAACGTGGAGCCGCGTGCTCACGTGGTTCTTGATGAATGCCTTC
ATATACTGCAGCGAAGGCGCAACCGGTGGGAGGATCAAAGTGACGTTTGCGACGACGGTGGAGCGCGACATAAAGGGTGACTACGGCTCCGCCGATGATG
TCCAAATGGCGGTGGCGTGCTAG