Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.24
Orientation:
(-)
Number of Exons:
1
Description :
Minus dominance protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RWP-RK domain15.551PS51519
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RWP-RK domainIPR003035
*** None ***
InsideOutsideTMhelix
1-414
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1245 bases(100 bases per row)
ATGGAGATGGATATGGAGCTCATCGCGTCGACGAGCGGCGCCGTCCCTGCGCCGTCCCCGACGGACACAAGCTCGCCCGTGCCGATGCCTCCCCGAGAGT
TCGTCGCAACGGCGACGCCCACGCCCGGCAGCTTTAAGAAGCGGCCATTCCCGACCGACGTCGCGCCGGTGGCCCCGCTCCCGATCCAGCTGCACCACGC
GACAACCATGCCAGTTGCCGCCTGCAACTTCTCCGCGCTCAGCCACCACTTCCACCTCCCGCTCAAGGTGGCGGCCGAGAAGTTCGGTGTGCGTGCTACC
GCCTTCAAGAAGCGCTGCCGTGCCATCGGAATCCGCCACTGGCCGTACCGCAAGGTGCGGTCGCTCAAGCGCTCGCTGCAGGAACTCGCCGAGTGCAAGC
AGCAGGCTGACAACGGCTCTGGCCCGCCGCTCACGGACAAGCAAGTGCGCCAGCACGCCGTGTACCAGAGCCAGCTCGCGCGTCTGCTCGCGCCTGAGAC
GTACGGCATCGACCCGAATGGCCAGCTGCTGCCGCACCACTTCTTCGCGCACGATGAAGATGTCGACTCGGACGACGACTCGTGCGGTTCCATGAGCCCG
CGTGTCCACCCGTCCCCGGCCGCTCATGGCGTAATGAGCCTCCCACCGGGTGTCACGCCGTCGCGCAAGACGAAGGCCCGCAAGCACTTCTTCACCGACT
CGCCGTCTGGATCGTCCTCGTCACACGACGGCATGTTCTTCTGCGGTCCAATGACGACGGTCAACGGCGCGATCTTCGACAGCAGCTACCTGTCGGGTGC
TGCGGCTGCGGGTGATCTACCGCCTTCCTCGAGCCTGGGCGGTGCTCCTGGACTCGTCAACGCTCACGCCGGACTCGCCTTCGACTCGCTGTACGACCCG
TTCGGAGGCATGGACGACTTCGCGGGGAACGACCACCCGTCGTGCGGCTACTCGCTCGACTCGGTCTCGTACGACTTCTTCCCGCTGCACCCGTCGCCCA
CCATGGCAGCTCGGAAAGCAGTCTCCCAGGCGACGTCAGCGCCATCGACGTGCTCTTCGTCAACGGCGACCTCGTCTTCCTGCACATCACGCACCTTGTC
CGTCACGGCCGGAGTTCACAGCATCAGTGGAGCGACGACTACCACAAGCTCCAGCTCACTGGTCGGGACACCGTCGGCGGGCAACGACGTGACGGATGAC
GACATCTTCCGGCACATTTCACCCGAGTACGGCTGCCTCGTCTAG