Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.37
Orientation:
(+)
Number of Exons:
5
Description :
EREBP-4
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-221
NN-scoreoddsWeighted Score
0.7794.6010.009
*** None ***
TypeScore
mitochondrial783
GO
*** None ***
*** None ***
*** None ***
Sequence
        998 bases(100 bases per row)
ATGGCGCGGCGATCAGTCAAGACACCGGTGGTGCTGAACGTCTATGACCTCGTCGAGGCCAACGAGTACATTGCGCGTACGTCTCTCTGTCATTGCTGCC
GCTCAGCTGGTCCACGCCCCCTTGCGCTTGAGTGTAGCGAGCGTTCTTGGGGTGTGAGCCAAAGCGCCATACTAACCAGTTTAACTCGTCGTGTGGGCAG
CGCTCGGCGTCGGCATCTTCCACTCTGGCGTCGAGTTCGGCGGGGACGAGTACTCGTATGCGAGCGGCGCTGGCGTGTTCGCGTCGACTCCGCGGGAGGC
GCCGGGTGCGGCTTGCTTTTCTAGGTGTAGTGAGACAACTAGGTCGGCTAACCTGCTGCGCTGCGAGGGACAGGGGCGACGTTCCGCGAGTCAATCAACA
TGGGTCTCTTCAACGGATCAGCCAGCGAGGCGCGCCAGCTTGCCTTGTCGCTGCGGCCGGACTTTGACGGCGACGAGTACAACTTACTGACCAAGTGAGT
GGACTCGGCTTTTGCGTTGTTTCTGGACGCTTCGCTAACTCTGGGCCGCTGCAGGAACTGCAACACGTATGCAGACGCGCTGTGCCAGTTGCTCGTGGGG
AAGCCCATCCCAGCGTACATCAACCGCGCCGCGTATCTCGGCTCCTTCCTCTCGTGCCTGCTGCCGTCCGAGTCAACTGCACAGGCGCCAGTTGGGGACA
CAACCGGCGCGGGTCATGCCACCTCGCTTCCCCCACGACGATCGGACTTTATTTACTCCCCTTTCGCTGGTAGGCGTCGCTTGTTCGCTCCATCTCGGCG
AAGCCTTGTTGTCCGTATTATGGCTCAATATTTGTTGGTTTGTTCACAGGCGAAGGGCTGACGGTGGGCGGTGGAGGTCCTTCCTCCTCGTCGTCGACGG
CCTCGGTTGCCGGCAGTGACACATCGCTGGCGGACCGGCGAGAGAAGGTGCGCATGGCGGCGCTGCGGCGGTTCGGCGAGTCTGCCGAGCAAGCGTAG