Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.30
Orientation:
(+)
Number of Exons:
7
Description :
Conserved gene of unknown function
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5610.70221
InsideOutsideTMhelix
611-729
1-590
591-610
*** None ***
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
Cluster Id
3765
Sequence
        2635 bases(100 bases per row)
ATGCGGCGGTGGCGGAGCGTGCCGTTACTCCTGTGGGCGTGCGCCGCCGCGGGGTTCGGCGAGCCCGGATCTGCTGCTGCGGCACCACGCACGATCGCGC
CGGACACGAGGGGCCTGTGTGACGAGGCGCGGCTCAAGCGCGCGGCCGTTGTGGTGTTGTCCTCCCACTACGACGTCGAGCTAGGCGCCGTTGCGGCAGG
TGATTCTGCGCACGTCGGCTTCCAGTATATGGTACGAGCAATACTGCGGCGTCATTTGTCGGACAGTGGCATTAGCTGACGGTACGAGCGAGCGCAGAAA
CCCGCAGAGGCGCTGTTTGCGGCGCAGGCGCTCGCACATGACGACTTCGTGCAGGCATCGACCCACTTCCAGTACGCCTCCTCGTTCATTTTGCCCCGCG
TTGAACGGGAGCTGATGCGTGCTTGACAATAGGAACGTTTTCAAGTATCAGCGCGCAGACGGCTTACTTCCGCATTTGGTGTACGGGCCGTCCGTGAAGC
CGGCGCTCGAGTGGATACCCAGCAACCAGACATTTCACCCTGGGCCAGCGTTTTGGAACGCAGCTGAACCGCCAAGCAAGTCTAGAAACCAATCCAGAGT
TGTAGCAACGTCGACGCTGCTCGCCCCGCCGGTCGCAGCCGACGTGGCGTGGCAGATCTTTCGCCTCGCGCCGTATGACGCCGTACTGGGTGTAGTCAGC
TACAAGACAGCTGCGCTTCAGTTCCTGTGCAACACGTTCGAGCCTCTGAAGCGGTTGCACGGATACATTCTTACGAACAGATCACTTGCTGGTCGAGATG
ACGAGGGATCACGAGATGGCCGACTGGCAGCCCATGTAAGCGTGCTTTGATGCATTTGCAAAGTGCCTTTCAGCCTATGTGGACTGATTTCATCTGTGCC
TGGACAGCATCCGTGGGAAACATTCTCGTCACTCTCACCGCATTGGAAGGCATTATTGACTAAGGTGAAGACAGCACCCGATTACGACGCGGTTATTGCC
TCCATTCCAGAGACTGCCAAACAGCGGTTCGCGGCTGGCGCGTTCGGCGCAGGGTGGTCCACGAGCGCAGCCATCGAAGATATGTACGAGCCAATGATTT
ATTTGGCGTCAAGTAACCGTAGCCGTGACGTCGATGGTGCTATCGATGACGATCGACGGGAGACGGCCAAGGATCTGTTCGCCATAGCTGACGTGGAGTT
CAATGCGCTAGTCCTCAAATCTGCGTTGAGTTTGGTGAGTATCGCGCGAGTCCTAGCAGAGCACTCGTCTGTCTGCACAGACTTCTCGCTGTCGAAGGAA
GAGATGGTTAATGAATTGGGGAGGCTGCGGAAGGCGGCAAACCAACTTCAAGATGCTATTGTCGGAACCAACGAGACGATCGGGTTCTGGAACTCCACCA
CCAAGGTGGGTCGATTAATTATCTGCCCGCTTTGTATTGATCTCCATATCTCTGACAGCTGTGTGTTCTGTTCAAGCGCAGTTCTTCAATGACGCTGACA
CCATTTCGACGACAAGCGTTTTCTCTTTGCGTGGCGTTATACCTGCGTACGCGTCCGAGTTGCCTGAATCGCGAAAGATGGGCCTTGTAGAGCATTTCCT
CACGCCTGTGAGCACATTTGGATTCTTCTGTGCTAAGTTTCCGGCTCCGTTCTTCGGGTGTTCCGACAAGGAGAGTGGCCGTCGCACGACCTGGATGCTG
TACGATTACTTTCTCCAGCGGACCTTTTCCACGGTACGATGCAGTGTCTGCATGCAAATATTGCGTCGTGCTCGCGACAGCTAACCCATTGTTTGCACTG
CATGCTACCGGTGAAAATGCACGCGTAGAATGGCTTCCCTGGGATCGCCGAATTTGTGCGGAACAAGACGCGAGACATGGTGTGTGCCACTGCGACCACA
TCGTCGCCGCGGACACCAAGCTCAGGTGTTGACGCGCCGAGTTATCGGGTGGTGCTCTCGCCCGCATATGACTCCGACACAGGCGCGGCACCCTTCTCTG
TCTTCGATGACGGTTATATCGGCTCGACTCTGGCGGCGGCTACCTTTCTCAATATCCTGCTACCTGCAGGTGGGGAATGTCTGTCTGCTTTTTGCTTCTC
CGTTCAATGACTTACATTTGTGTGTGCTCCACGCTGCTTCCTAGTGACTGCACCACCGAGCCCCGACCAGCCGCCAGTTGATCACCGGATGCTTACGGTC
ATCATGTGTGTCGAGCTGGTCGTTGCGTTCGCTGTGGCCATCGGTTGCGTGTTCTTCTCAGTTTACTTCGTCGTCAATCGTCCCCGCGACCGTCGTTTGG
CATCTTGGAACGGCGACATGCGCAACAAGCAGAGGCGACGATCGCGCGCTAGGTCAGACCGCCGTGGTGGCGACTCGGACGTGGAGGACGGTCAGTCGAT
GGGATCTTGGCGACGCCAGTACTCGGTGTCGTCGCTCAGCGATGACGGGGGATCGTACTCGTCAGTTTCGGGACAGGATCGGGAGCAGGCAGTTGATCTC
GAGGAAGCTCTGCTATCAGACGACGACGAACACGCCTACGGAGCGATCGAACAGCAGGAGCCGGCACGCCGTACAATGACCAGCTCGGCATGGGAGTCCG
TCAAAGAGGCGCTTGCTGCGATTAGCCCGTGGTGA