Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.31
Orientation:
(+)
Number of Exons:
2
Description :
Proton-dependent Oligopeptide Transporter (POT) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-40
142-147
213-218
298-305
402-413
495-505
563-580
64-118
171-189
242-274
326-378
437-471
529-542
41-63
119-141
148-170
190-212
219-241
275-297
306-325
379-401
414-436
472-494
506-528
543-562
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1814 bases(100 bases per row)
ATGGGGAAGCCAGTCGCGTCGCCGTCGCCGATCCTGACGCCTTCGTCCTTCACACCCGGCAGTGCTGCAGTGTACAGCACCAAGCTCTGGGATGAGCGGC
CGCTCAAGTACTCCAAGAATGTCATCGCTCGCGTGTGCGTCTTTATCTTCATCCTGGCCGTGTGCTCGGAGTTGACGCACTTCAGCGTGGTGCAGTCGCT
CAAGAACTTCTTCCAGAAGCTCGGCTGGTCCAACAAGGGGTCCAACTCGATGAAGACCACCTTCGACTCGATCTGTCAGTTCGCGTGCATCCTCGCAGGC
TACGTCGCGGACGAGAAGCTCGGCAAGTTCCGCACACTGCTGACTGCAACCACGATGAACGGCGTCGGGTTGATCCCTGTCGCCATCGCGGCGCTGCCCA
CAGTTCTCGCGCACCTGGGTGTGAGCAAGGCGCTCTTCAACATCGGTTTGTTCGTCGGCGTCAGCCTCACCCAGACGTGCCTCATGTCACTGTCCGTGTC
GTTTGGCGGCGACCAGTTCTCGCCGACGGCGCCTCCCGAGGAGAAGGCCAAGTTCTTCAGTATCCATTACTGGGCCGGCAACATCGGCACCTTCCTCGCG
TACCTCATCTTCCCGACCGTTTCGATCCATGGCATCGGCGCCATCTCAGCGGAGTACGGCTACTTCTCCGTCTACGTGGCGGGGTTCGTGCTGATGCTCT
TCGTTGCGGCGCTGCTGCTCACCACACGCCCGCGCTACGTGAATGTACCGCCCACCAAGGACTCGATCGGCGTAGTGCTCAAGGTCGTGCTGAACCGGGC
CAAGCACAACTTCCGCGCTCGCATGATCGTCATCGGGACGGCTGCGTACATTGCGGCGCTAGTGCTGAACGTACCGGCCGCATTCCTGTCGGACCATGGC
GACGTCGGTCGTCGTATTTCGTACTGCTCGGGAGTGTTGGCGTTCTTTGGCACAGTCGTGTGGGTCTACTATGGTCGCGACTCGTCGTTCATGGACGGCG
CCAAGGACACGGAAGGCGGCGAGTTCGACAGCGAGATCGTCGACGGAGTCAAGCAGGTCATCCGCATTCTGCCGTTCAACGCGTTCAACGCCTTCTGGTG
GATGTGTCAGAACNNNNNNNNNNCGCCAACAACCAGTCCATCATCCAGCAGACCGACATCCGTCTCGGCAGCAGTCCCGACTCGAGCCAGATCCCCGGGC
CGACCGTCCAGGGTTTCAATCCGCTGTCTGCGGTGTTCATCGTCCCGCTCCTCTACAAGGTGGCGTTCCCGCTGTACGAGAGGATCGTCGGCAAGCCTGC
GAGCAAGTACGGCAAGATCCTGACGGGGTACTTCATCGCGGCTCTCGCCATGTTCTGGACGGGTGTCTACGAGATCATCCGCCGCAACGCCGGTCCGCTC
ACCTATGAGGATGCTGAAGGTGTTTCCCAGTTTATCCTGAACAACGACGGACACCAGGTCATGAATGACATCAAGTGGTACACTGCCATCCCGCAGTACT
TCCTAGTGTCGCTCGCCGGCGCATTCATCGTGATCCCGTCCTACGACATTTGCTACTCGGAGGTGCCGCAGCGCATGCGCAGCACGTCGGTGGCGCTCAG
CTTCTTCGTCATGTCGATGGGGAGCACTATCCAGTCGACGATCGTGCTGCTCTTCGGCAAGTACATCACGACGGACCTAAACGACGGCCATCTCGAGTAC
CTCTACTATGGCCTCGGCTCCATCATGTTCGCGGTGGCGCTGGTGTACATTGTCGTCATGAACGAGATGAAGCTCGGTATGCTCCCGCCTCTCGGCAAGG
ACCAGACGAAGTAA