Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.16
Orientation:
(+)
Number of Exons:
1
Description :
Nardilysin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1077
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
501
Sequence
        3234 bases(100 bases per row)
ATGGCGTCGCCGAGCGGCCGCGCGTGCCTGAACGCGTTCCGATCGCCTGCCGACCTGAAGAACTACCGGCTCATCACACTAGCCAACGGGTTGGAGGCGC
TGTTGATCCAGAGCGACCAAGCCGGTCGGTCCAAGAGCGAGTCTGTCAACGCCAGCGAGCCTGACGAGGAGCCGGCGGCTCTCCGATCAGCTAGCCGCAG
TCGCGGCGTCTCAATTAGCAGCTGTCGGAGCCGGGATGACGACTCTGACAGCGACACCGAGAGCGATGAGACGTCACAGGACGGAGGTGAGGCTTGGAAG
AACTCCCGCCACGCAGCCGCGTGTCTGACGGTCGGCGTGGGCAGTATGGCGGACCCGCCGGAGCTGCGCGGACTGGCGCACTACCTCGAGCACATGCTCT
TCATGGGGAGTGCCAAGTACCCGGACGAGAACGCGTTCGAGGCGTTCCTGAGCACGCACGGCGGCTACAGCAACGGCGCGACCGAGTGTGAGACGACCCG
CTATCTGTTCGAGGTCGGGCCGGCGCACCTGGCCCAGGCGCTCGACATGTTTGCTCAGTTCTTCGTGGCGCCGCTGCTCGCGCCGGACGCGATGGAGCGC
GAACTGCGCGCGATCGAATCGGAGTTCAACCGTGCCAAGCACAACGACTACGTGCGTCTGCAGCAGGTGCAGTGCGAGACGTGTGCGCCTGGCCACCCGT
ACGACAGCTTTAGCTGGGGCAACGAACAGAGCTTGGCGGCGATCCCACAGGCGGACAGTATCGACGTGCGCGCGCGCATGGAGCAGTTCTACCGCGAGCA
CTACTCGGCCCACCTGATGAAGCTGTGCGTATACGGCGAGGACACGCTCGATGAACTGGAGAAGTTCGTTGTGGACGCCTTCAGCGCTGTGCCGAGGCGT
GACGCGGCCCAAGTGAGGCTGTTTGACTCGCTGCCGCCTCCGTTCGGCGTCCAGGCAGGACAGCAGCCGACGCTCGTCAAGATCGTCCCGGTGCGCAAGA
CCCACCAGATGCACTTGTACTGGACGTTGCCGCCGCTGCTGACGCAGTACCGACAGAAGCCGTGGGAGTATCTGTCGCATGTGCTTGGCCACGAAGGTTC
CGGGTCCATCACGACACTGCTGCGTGATCGCCACTGGGCGACGCACGTGTCGACGGGAATCTCCGAGAGCGACGGGTACGAGTTCGGCTCGTTCGGCAGC
CTGTTTGAGGTCAATGTGGCGCTTACGCGGACAGGGTTGCGCCACTGGGAAGACGTCGTGCAGATCGTGTTCGACGCTCTCGCTTTTCTCCGCGGGTCGA
CCGGCGACGCCAAGCTCCCGGCTTGGATCTTCGACGAGCTGCGCGCCTCCAGCGACATGGACTTCCAGTTCCAGGAGGAGCAGGACCCTGTGGCCGTGTG
CCGCCGGCTCAGCGACATCATGCAGGACCGCTACGGCGTGCAGCGGCCTGGTGATCTGCTGCGCTACGACATGATGGAAGGTCCATTCGATGAGCAGGAG
ACGCGGCGGCTGCTGGACATGATGACGCCGCAGAACACTCGGGTATTGCTGCTGTCGCATACGTTCGAAGAGGATTTCCAAAACGACAAGAGCGTGCGGA
CCGAGCGCTGGTTCGGTGCCAACTACACGGTGTCGACCATCCCACAGCAAACGGTCGAGCGGTGGAGTTCCCCCAGCGACAGCGATGACATCCTCGCGCT
TCCAGTTCCCAACCCGTTCATGCCGCAGTCGTTCGAGGTGCTGCCTCTCGAGTCTGACGACGACCTCAAGACAACAGCCAGCGATGCTCCGCCCGAGGTT
ATCCTGACGACGTCGCTGGGCAGCAAGCTTTGGTACAAGCGAGACCGGACGTTCCGCGTGCCCAAGACGAACGCCAACGTGCTGCTCTGCTTGCCGGCCG
TCACGGCGAATGTGACCAACTACGTGTACGCGCAGCTGCATATGCGGGCGGTGCACGATGCGCTCAAGCAGGTCGGGTACCAGGCCAGCATCGCAGGACA
CTCATTCGGTCTCATGGTGCGTGACCTCGACATTGAGCTCGAGGTCGCCGGCTTCAGCGACAAGGTGCCCGAGCTGGTCCAAGTCGTTTTGCACGCGCTG
CTTGCTACAAGACTCACGGACGCAGCCACGTTCAAGCTGCTGCGGGACGAGCTCGCTCGCGAGTACCGCAACGTGAACCTCAAGCCGGCTGCCAAGGCGA
GGTATCTGCGGCTACAGCTGCTAGAGCGCGTGGCCTTCTCGGTTGACGACAAGCTGCGTGCTCTCGAGAGCGGTCAGATCACGCTCGAGGGACTGGTCGA
GTTCCAGGAGCGCGTGCTATGGGAGGGCAAGCAGCCGCTCGCATTACGCGCGCTGGTGCACGGCAACATCTCCGCTCAGGACGCGAAGCAGCTGCTGCTG
GACGTCGAGAGCGCGGTGTCAACTCGAGCTGCGAGCTTCAAGGTGGAGGAGAGGTATGAGCCAGCGACGCCATTGACGCCGGCACGACCGCGCACGATCG
CGCTTCCCGCCACGGCGAACGGTCTGCTGCTGCGCGACGTCAGCGAGCACGCCGAGGAGACCAACTCGATGGTCGAGGTGTATTTCCAGCTCGGCCAGCT
CGACGTGCAGGACCGCGCGTACGCCGAGCTGCTGCAGCAGCTCATGGCCGAGCCGCTCTTCCACGAGCTGCGCACGACGCAACAGCTCGGGTACGAGGTG
CACTGCTGCGTGCGAGACACGCACGGCGTCGTGGGGTTCAGCATCGCCGTGCAGTCGGCGTCGCACGCCGCGGGCGAGATCGCCGTGCGTATAGACCGCT
TCGTGGGGGACCAGTTCCTGTCCTACCTCGCGGACGTGTTGCCCAAGGCAGAGGAGTTGGACGGCACGTTCGCTCGCCACGTGACCGCGCTCCAGCGGTC
CAAGTCGCGAGCTGACGCCACGCTGTCGGATGAGACAGACCGGTACTGGGAGGAGATCCAGTGCCGCCGCTACGCCTTCGCTCTCGAGAGCGAGATCGCC
TTGGCACTCGGCGCGTGCTCGATCGACGGTCTCGTTGCTCGCTATCGCCGCTGGCTCCTGCCGTCGGGATCGAGTCCGAACGGCGACGACGGAGAGCGGA
AGCTGCTACGGGTCCACATCGTCGGTCAGCAGAGCCCTATCCTGCCGCTGGAGCAGCTCGTGGGCGAGGACGAGGTGCCGCACGTCATCGATGACCTGCG
CGCCTACAAGCGCGTGCTGCGGTGCCACTGCTGA