Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.7
Orientation:
(+)
Number of Exons:
4
Description :
Dicarboxylate/amino acid:cation
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sodium:dicarboxylate symporter3.9PR00173
Sodium:dicarboxylate symporter3.9PR00173
Sodium:dicarboxylate symporter3.9PR00173
Sodium:dicarboxylate symporter3.9PR00173
Sodium:dicarboxylate symporter3.9PR00173
Sodium:dicarboxylate symporter3.9PR00173
Sodium:dicarboxylate symporter3.9PR00173
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
sodium:dicarboxylate symporter activityGO:0017153IEA
membraneGO:0016020IEA
dicarboxylic acid transportGO:0006835IEA
KO ID
K05612
K05612
*** None ***
Sequence
        3611 bases(100 bases per row)
ATGGAGCGAGGTGGCAGTCCGCCGGGGGTCGTCCTCTACGAAGGGAACCGCAGCAACGAAGACGTCATTACGCCGACTGAATCGCTCGGCGTGCCAAACC
AGTACGACGCCAAGCTGTCCACTAACCAGAAGGCGGGACTAGCCACGCCGCCGCGGTTCCTGCGCCAGCCAGACGAACTCGACGCCGTGTACCCGGATGA
GGAGCCGCGCTGCGCCGTGCTGCGTCAGCCTACGACCCAGATCCTGATCGGCGCCTTCGTCGGCGTGATGCTCGGCGCGCTGCTCTCGAACCTGGAGGTG
TCGTCCGACGTGAGCGAACTCGTGAATTTGCCAGGCACCATCTTTCTGCAGGTGCTCAAGTGCTTCGTGATCCCCATGATCTTCACCAGTTTGTCCACGG
GGGTGGCCGACATCGTGCTCATGGGGAAGGTGTCGGTGATCGGCACGCAGACGGCCGCCTACTTCATCAGTCTCTCGCTGGTGGCGGCGATTCTGTCGAC
TGCCATCTCGATGCTGATGCGAGGACTGCAGCCGAACATCAACCGCGGGAACCTGACTGCAGAGACGGCATATCTGAGCGTCGAGTGCACCGATGGCACA
TTTTGGTCAGCCAACTCGACCAACTCGACGACCTGTTCAGTCGACGCGGCCGGGAACGCGACCACATTGCAGCTGATCGACTTGACGGGCGTCGTTCTCG
TGGACGCAACGGCCAGCGCGGCGACCTCGGTGACGACGCAGGTGACGGAGATCCTTGGCGAGCTGCTGCCGAACAACATCTTCCAGAGCTTCCAAGACGG
CACGCTGCTGAGCGTCATCACCTTCGCGATCGTGTTTGGTGCTGCTGCTGTCAAGGTGAGCTCTCGCGAGAACAGTCCGCTGCTGGCGGTGCTGGACCAG
ATGAACCGCGTGTTCTTTCATATCATCCGCAAGTTGATCGACTGGAGTCCTCTCGGCGTGCTGTCGCTCGTGGCGGGATCGCTGTNNNNNNNNNNTGGGT
GAAGCCCTGGCGCACGTCGGCATCATGATGCTGAGCTATATCATCTCCGTCATCATCTTCGAGCTGATGTTCCTCCCGGTGATGCTGTGGATCGCGATCA
AGAAGAATCCGTTCCCGTATATGCGGTCCATGCTTCCGGCCGCGTTGTTCGCGTTCGGCTGTTCGTCTTCGATCGTCACGCTTCCTGTCACTCTGCGGTG
CGTGGAGACAACCCGCGAGGTGTCGCGTGGGCTGCTGCACTTTGTCATCACGATCGGCTGCTCGGCTCACAAGAACGGGTCGGCCATCTACTACCCCGCC
GCAGTCGTGTTTCTTGTCTCGACTGCCGAGAACGAGTTGTCATTGGGATGGTGGCAGGTTGTGCTCATCGTCTTCATCTCGCTGCTTGGGTCGCTCGGCA
CGGCGCCGATCAGCAGCTCCAGTCTTGTGGTCATCTACTCGGTGTGGCAAACTGTTTACCCGCGCGTCGACATGCCCGCATCGTTCAGCTATCTCGTGGC
CATCGACTGGATCCTCGACCGCATCAACACGGTCTGCAACGTCGTGGGAGACACGTACGTAGCCCGCGCCATCGCCGAGCAGGTTGATGAAACCTACGAC
ATGACCCATAACCACGAATGAAAGTCATACTGCGGCGTGACTCAAAAGCACACGATGCGTGATTTCCTTTGTCGAATCGAGCTTTCACAGGTGCGGTTGG
TCTGCTTCATACAGCAATTTAGAACCAGAGGTCTGGCTCTGGCACACCTCTTGTGTCAACTTGACCTTGTTGAGCGTGTTGGTCGAGTGAACGCTTGCAG
CTCGAATCGGCGCCATATCTCCAACCGCGTTTGAACCGATGTGTCGCGTTTGGTCCTCAAATCCACATTGCACTTGCGACCGAAATAGCGAACGGATCCA
GTCAAGTCAATACGACGCTTGCGGCACCGCAGCATCTCCTCCGACGTTTGGGCTTCTTCACGTCCAAACCATGGCGGACCGCCACGGAGTCGTGCTCTTC
AATGAAGCTCAACCCGACCGCAGGAACGGCGACGACGCCGATGTCCTCACTCCGACCGAGTCGATCGGCATGCCTGAACACTACTCGGACTATGCGCATC
TCCGTAAGAACGATCGTTACTCAAAGTCTGGACTGGACACACCCGAGCGGTTTGTACGACAACCTCATGTGGTCGAGGCAGTATACCCTGAGGAAACAGC
ACGGTGCGCATTATTGCACCAGCCCACGACGCAGATCCTGATCGGCGCTTTCGTCGGCGTGCTGTTGGGGGCTCTGTTGTCCCACTTTGATGTGTCGTCC
GACGTCAGCTTGCTCGTCAACTTGCCAGGCACCATCTTCCTGCAGGTTCTCAAGTGCTTCGTCCTCCCCATGATCTTCACCAGTCTCGCCACGGGAGTCG
CGGACATCGTACTCATGGGGAAGGTCTCGGCGATCGGCACACAAACAGCGGTGTACTTCATCAGCTTCTCGTTCGTCTCATCCGTCTTGTCGACCGCAGT
AGCGATGCTGTTGCGCAGTCTTCAACCGCACACAGATCGTGGGTCTCGAGCATCAACCAAAGCGCTGCTGAGTGTCGAGTGCGCAGACAGCAACTTCTGG
ACCGCAAACTCGACGAAAGCCTTGGGGTGTACTGCTCACGCGGCGAGCAACTCGACGATGCTCCAGCTCATCGACATCAAAGGAGTCATCCTCGGCGACA
AGACGGCGAGCGCGGCCACGACGGTCAAGACTCAGATCAGCGACATCCTCGGCGACCTGCTGCCGAACAACATCTTCCAGAGCTTTCAGGAAGGCACACT
GCTGAGCGTCATCACCTTCGCGATCGTCTTCGGCGCCGCGGCAGTGAAAGTGAGTTCCCGCGAGAACAGTCCGTTGCTGGCGGTGCTCGACCAGATGAAC
CTCGTCTTCTTCCGGATCATCCGCAAGCTCATCGACTGGGCACCGCTGTTCGTCATGTCGCTCGTAGCTGGGTCCCTGTCGAGCCAAGTCATGGTGATGG
AGGCCATCGCTCACGTAGGCGTCATGGTGCTTGGCTTCTTGACTTCGATCGTCATTTTTGAGCTCGTCTTGATGCCTTTAGTGCTCTGGCTCGCCATCAA
GACGAACCCGTTCCCGTTCATGAAGGCCATGGTTCCCGCCGCACTCTTCGCGTTCGGCTGCGCATCGTCACTCGTCACACTCCCTCTCACCCTTCGCTGC
GTCGAGTCGACCAAGGAAGTTTCACGAGGGCTGTCGCACTTTGTCTTGACGATCGGCTGCTCGGTGCACAAGAACGGCTCGGCCATGTACTACCCCGCAG
CCATGGTCTTCCTCGTGTCGACGGCCGAGGAGGAGCTCGAGCTCGGGTGGATCCAGGTCGTGCTCATCGCGTTCGTGTCGCTGCTCGGGTCGATCGGCAC
CGCCCCCATCACGAACGCGAGCCTCGTGGTGGTGTACTCGGTCTGGCAGACCGTGTACCCGAGCGTGGCCATGCCGGCGTCCTACAGCTACCTCGTGGCC
GCCTCCTGGTTCGTCAACCGGTTCAACACGGCCTGCAACGTCGTCGGCTCGGCCTACGTCGCGCGCATCATCGCCGAGCAGGTCGACCAGACGTACGAGT
CGGCATCGTGA