Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.15
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
C2 domain11.004PS50004
HmmSmart predictionP-Valprediction_id
C2 domain6.4SM00239
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-343
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1032 bases(100 bases per row)
ATGGCGTTGGCGCGGCGCGGCCCGGCGCAGCTCAAGGCGCGCGAGGACCAGGCGGCGTACCTGTACGAGAAGCACGTGAACCACCAGGACGGCGTGGCCG
GCGCGCTGTCCATCCGGCTGGTCGAGGCGCGCAACCTGCGCGCGGCCTCGTCCATGTTCTGGGTGCGCACGTGCAACCCGTACGTGATCTTCCGCGTCGG
CAAGCAGAGCGTGCGCAGCTCGACCATCCAGGACAACGACAACCCGTCGTGGCGCCGCGAGCTGCTCGAGTTCAAGCTGCCGAAGCTCAATATGAAGCGC
GCGCCGCTCGACGAGCACTCGGACGTGCGCATGGAGCTGACGGTCGACTGCATGAACGACGACTCGCTGGCTGGGATGGCGACCGAGGCCGTTGGGATAT
CGAGCGGCTCGGTGATCGGCACGGCCGTCGTGGACTTCACGCCGCTGATGGAGGGCAAGGAGGAGGTGATGGACCGTTGGGTCACGCTTAGCGGCGCGCT
TCCCGTTGGCAGTCCGCCTAACGGCTTTGGCCCCGCGCCGACCAAGAAGTCCGAGAAGGAGATCGTGCTTGGCGAGGTGCGCATCGTGCTGCAGTACGAG
CCGCACGGACTCGAGCCGCGCGTGGGCGACGTCGTCAAGCTCGAGGGCTTCGGGTCGTACCCGTCGGCACTGCTCGCGCCGATTGACGAGCTGGAGCTGA
CGGTCAAGAAGACGAGCGGCAGCTACTTGCTGTGCAGCTACGTGACGAAGGCGGGGTTCGACGCGACGCTGCGACTGCACCGCAATAACGTGTTCGTCGC
GCACCGCGGCAGCCTCGTGGACCGCGTGTATGCGACGTTCATCGCGCAGCCGCTCGAGTTCGTCGGGTCGACGCCGCTCGGACTGGCGTGCAAGGATCTG
ATGCGGCCCTACATCAACGTCGCGCGGACGTTCAGCATCCCGGCGCTGGTGGCAGCCAAGGCGACGGTTATGACGACGTTCCGCGCGTCGTCGGCGGCGG
TCGGCGCCATCGTTGCCTCCATGGATCATTAG