Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.47
Orientation:
(+)
Number of Exons:
2
Description :
Serine/threonine-protein phosphatase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase3.2PR00114
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase3.2PR00114
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase3.2PR00114
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase3.2PR00114
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase3.2PR00114
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase3.2PR00114
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related12.046PS50178
EF-hand domain7.01PS50222
EF-hand domain11.612PS50222
EF-hand domain9.241PS50222
EF-hand domain10.887PS50222
HmmSmart predictionP-Valprediction_id
FYVE zinc finger8.5SM00064
Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase4.6SM00156
EF-hand domain83SM00054
EF-hand domain0.012SM00054
EF-hand domain1SM00054
EF-hand domain3.1SM00054
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-1219
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
hydrolase activityGO:0016787IEA
calcium ion bindingGO:0005509IEA
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        3730 bases(100 bases per row)
ATGGACACGGAAGGGTTTTCGTCTCGGGCCTGGCTCGGCCAGTGGGGGTCCCCCGAAGGCGAGCCCGTCAACAACTACTACGAGGACCACAAGCTGATGG
AAGGCGCGCTCATCAAGCTCGGCGACTACGCGCACTTCCGCTACTTCCTGCTGTTCCGCAACGGGCGATTCTGCTACTATGAGCTGCCGATCCCGACCGA
GGTGAAGCCCGGCGAGCAGAAGCGCCGCGTGCACCTGACGCTCACGGCGAAGCACCTTCGTGGCGTCATGATGCTCAACGCATCCGGCAACTCTAAGGAC
GCCACCAAGTCGGATGACGAGTACGACGCCGATCTGATCAGGCGCGGGTTCGTGTTCAACCGCAAGCGGCTCGAGATGCAGCTGACGGGGTACTCACCGA
CTGGACAGCTCATGTGCTGGAAGCTCCGAGCAGCGAAGGACGCCATTTTCGTCAAGTGGGAGCGCGCGTTCCGCTTGGCGCTTCGACCCATTTGGGTACA
GAACACCCCCAAGTGCATGGTGTGCAATCGAGACTTTGGTTTCTTCAGCCGGCCGCACCACTGCCGGTAATGCGCAGTCACTGTTTGTGCGAGTTGGCGA
GGCAAGTGCTAAGTTGTGGCTTTGTTTACCGAACAGAAAATGCGGGACGTGCATGTGTGACGACTGCTCGGTCTTTGCGTCGCGGCTCCCGATGCAAGGC
TATTACGAAGAAGTGCGGATATGCAGAGATTGTTCGCCTATCAAAATCCAGCGGTCGGCACTCAAGGTCGGCACGCGCGTGCTGGTGTACGGGATTCTGG
TGGGTCGTGTGGTCCAAGTCGACGCTGCAGACACGTCTCAGGACGGCCATGCATTTGTGAACGTGGCGCTCGAGAAGAAGAACAGCGAACTGCGGAGCTT
TTCACTCGAACACGTGGAACTGTATTCGGAGGCCGTCCTATCAGCGAACCGAATCAAGGGGGCGATTCGACAGCACCTCGCGCACGCCGTGTTCCGAACG
CAGCTGAACTTCAGTACGTGGAACCTTCTCGAGACGATCCAAGAGCAGAAGACGGTGCAGATGGTGCGTATTCTCAACAAATCGACCAGCATCACGGAGC
TTCATTCGATGGTGCCGACTCTCGGCTCGATGGGCTCGATGGAGTGCATGTTCATCCCGGCCGACAACCAGACAGAGCAGGAACGCGTGCGTGCGTCGCT
CGCGCATTATCGTGGCGTGCACGTGTTGTTTCCTTTGCGATTGGAGACGGTGATGAAATTGATCGACCAGTTTCGGAACGGCATTCTGCTTCATCGAGTG
TTCGTGCGCCAGATATTAGACGAGGCCGAAAAGCTCTTCAATGAGTTCCACAAGTCGCCGATGAACCTGATCAACGTCCCTGTCGGAGTTCAGCTGATCG
TGGTTGGTGATATTCACGGTCAGCTTGAAGATTTGCTCACTATTTTGGACAAGAACGGCGTGCCAAGCAACAAGACATGGTATCTATTTAACGGTGATTT
CGTGGATCGAGGGTCTCATGGCATTGAAGTGATGCTGCTGCTGCTTACGTTCAAGCTGCTGTATCCCGAGTTCGTGTTTCTGAACCGTGGGAACCACGAA
GAGCGGTTGATCAACGAAGTCTTCGGGTTTGAGGACGAGGTCTACACGAAGTACAGTGCCGAGCACGACGAGGTGGCCGGATGGGACGGACTCGGGACAT
CCATGAACTACTCGCCGATGAAGCTGTTCCAGATGTTCGAGACGGTTTTCGGTTTGTTTCCGTTATTTTCGCTGGTAAATGACAGCGTGTTTGTTGTTCA
CGGTGGGCTCAGCAACCACGAGAACGTGACTATTGGAGAGCTGCTTCAGCTTGATCACCATCGAGAAATCCCGACTCAAGGAACTAGCCGCGCCGACGAA
CTGTTCACGCATCTGCTGTGGAGCGACCCTCGCGATGAGGACGGTTGGAAGGCATCGAGTCGTGGCGCCGGGGTTGAGTTTGGACCGGACATCACTCGCT
CGTTCTGTGCAAAGAACGGTATCAGCCTCATTATCCGGTCTCATGAATGCAGAGAAGAAGGTTTCGACATTGTGCACGACGGCTTGCTGCTGACAGTATT
CTCGGCGTCGAGTTACTGTGGGTCGCAAACCAACAAAGGCGCGTACGTCCAGCTGCAATTGATGGAGAACCAAGAGCTGAAGCCGCACGTTGTCCAGTAT
TACTCTCAACCGCTTCAGAAGCTGTCGGATGCCGGAAAGAACGAGTGGCGAAAGAAGGCGGTTCGACTCGAGCGCCGAACGTTGATGTCTCTTGTGGAAT
TGATTTGCGAGAAGAAGAACCAGCTGGCGATGGAGTTCAATCAAGTGGACACTGCAGGAACTGGCCGCGTGACAAAGCTCCAGTGGAAAGCAACGCTTCA
GCGTGTTCTCGGGATCGAAGTCAAGTTCTTGTCGTACTTCAACCAGCTCGCGTCCATCGAGAACGATTCCCTCGGTGGAGTTGACTACCAGAACTTTCTG
AACCGCTACACTATCGAGTTGGACGGGAGCAACGTCGAGTGGAGACGCAACTTAATCCGCAAGGTCTGGCTGGGATTCTGCACCGCTCTGCCTCGCCGGT
CGGAAGTTGATTCGAACAAGTTAGATCTCCAAGAGAAGCTCCATCTCGCGTTTGACCTCTTTCAGACTCCTGGTTCAGGGAACGGTGTCGCTCCGAATGC
AGCGGGTGGTCCGGCGTACAATAGTAGCATTGCCAGCCAGCGCAGTCATGAGAACTACCTCCAGCACGGACTCGTGACGTATGAGGTGTTCCGGAACACT
ATTCAAGGGAAGCTTGGTCTGGGCGAGACACTGTCGGAGCAGCAAATCTTTGACTTGATGCAGCACATGGATCAGAACCACGACGGTCTAGTCGACTACA
TCGAGTTTTGCGCGTTCTTCTCTGAGTTTAGTCGAGCCGACTATTTGCAGGAGTTGTTCGAGGTTGACGACGCCAAAGCCATCAATTTGCTGCATCGCTT
CGGGTCATTCTTGCTCCAGTCCACGAAGTACAAGTCGCTCAATGACGCCTTCAACGCGTTCGACACGGATAGCGATCAGCGTCTGAGCCAAGACGACGTC
TTCAAGGCCTGCAAGGATCTCGATGTTGTCCCAGCACTGGACGAAATCGATGCGAAGCTGCTGTATGAGTCCATTCTGATCACGTACTATGGTGTGAATG
AGCGTGCGCAGTCGGAGAAGCTCGGGTTGAACTGGACCGTGTTCGAGGATGTGTTCTCGCCGGACAGCACGTTCCAGCGTCGCTTGTGGCTGACGAGCCT
CAGGGCTTCAAACACAAATCTGGCTGCGATGACGGGCGACCCCGCGATGGACGACGATGATAACAACCAGTCGTTTGTCAAGCCTCAGCCTTGGGCGGAC
TCGATGGTCGAGAGCGTCAAGCAATCGCTCCACGAGCAGCGTTTGTATATCAAGTTTGTGTTCCGGATGTTGGATCGGAAGCGCACGGGATATGTGACCA
AGGCCAAGTTCATTGCCGCCATGACAGCGATAAACGAAGAGCGCGGCTCGCCACTGCAACTCACCCAGATCGAACAGCTTGCTGATGCATTTGCACGTCG
GCGGAAGATCCGCAAGTCGACGCTGTCGGATGAATCAACTGAGTCGAACAACTTGTACGTGTCGTACCCAGCATTCCTTCGCAGCTTGAGGATCGTAGAC
TCTGAGGCACCTTCCAAGCTCGAACTGTGA