Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.20
Orientation:
(-)
Number of Exons:
4
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-238
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3768
Sequence
        1159 bases(100 bases per row)
ATGAGCGAGGACGAGTTCGTCGTGCTGCTGGAACACGCAGGGATCGTCGAGACCGCGGACGACAGCGAGCGCGAGTTCGTCGAGCAGGCGCAGCTGCTCG
CGTGGCTCGAGCGCGAGGGCATCGAGCTCTTCACCTCGCCGGCCGTGCTTGCCTCCCGCGCGACCGAGGACAGCAACGGCGACGCCTCGGGCCACGCGAG
TGTGGCGATGGGAGAAGCGCGCACTCGGCTAGCCAACCGCGTGCTGGAGCGGCTCCTGGCGCGCGAGTGGCTAGCTCCCATTCAGTTCAACGGCGGCGAA
GGCGACTCAACGGTGCGTTCTTGGGTCATACACGGACGCATTTAACGCATTTTGGCGTTGTGACTGACCTTGATGCGTGCGCTGTGGCTGCGAACAGGAT
TGGAAAGGGAAGCTGTACACACCACGTCTGCGTACGGCCGAAGCGTACCGGATTTACATCGAGAAGGACCCTTCGGTGCGTATGAAATCTGCCTGCCACT
CGCTGGGAACGAGCATGCGCGCCATGCCGTCCATGCCCACTGGCTGGTATTTGCGCGTACCTCTGTTTGGAGCTGGACGGTGATGAGGTTTCCTCGCTGC
CTTGTGTAGGAGTCGCAACTCGCGGCGCATGGAGTGAATCTGCGCGACCACGCGTTCCCAGAGGTCCGGATATGGATGATGGCCGCACCGGGGTCGCTCT
GTCCGAGAGGGCTGCCGCCTCGTGCATTGGTCCATTGTGCGACAAAACTCACGCGGTTCTTGCCGTTGTAGGTGGACGAGCGAGCCACTCGCGAGCAGCG
CGCGACCGCAATTGCTGCGCCGGTACGACTGGTTGAGTCGTTGGAATCGCTCAGTACTCGGTGTGACCATGCTTGTCGTCGTTCTATCCGTACAGGTTGC
AGATGAGGCTCAGAAGGCCCGAATTCGCGAGCAGCTGTGGCAGAATTGCTTCCCGACGTGCTCCGAGAGCTCCAGGCAAATGTTCCTCTCGTTCGACAAC
CCCGAGATCATCCTGTACGCGACGATGGGGTTGAACCTCATCAGCAACGGCATCAGCAGCGTCCCGGCGTTCTCGCGCGAGCTCAAGAGTATGGGCGTGA
GCTCCGAGGACCGTTCGGTCGTGGTCGGGTTCCTGGCCAAGGCATTCCCGTGCGACTGA