Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.29
Orientation:
(+)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-222
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        735 bases(100 bases per row)
ATGGCGAACCTGCGCTCGCTGACCCGCAAGACGTTCCACCGCTCGGCGTCGCAGTGGCTGGCCGAGGTCGAGGACGCCGACGCGCTGGTGGCGCGCCGCG
TGCGGCCGGGTGAGACGTTCACGGCCAAGGAGAAGCTGTGGACGCTGACCGAGATTTTCCCGACTGTCGCGTTCGAGGTGCGGCGCGACGTGCTGGCGGC
CGCCGACTTCCGCGTGGACGTGGCGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCTGAGCGACGTGGTGCGCGAGGAGGCGCGGCGCGGCGGC
GCGAGCGTCCAGCCGGCGCTGTGCTTCCACGAGCTGCACGGCGAGGAGGCGCTGGAGCACGACGTGGACGAGGAGGACTGGAGCGAGGTGATCAGCGTGA
GCGGCACGAGCTGCGCGTCGACCGGCGCGGAGCGGGAGCAGTGGGTCATGATCCAGGACGAGTGGGAGGTGCTGGACCAGGCCGGCGACCGCGTCCGGTC
GTTCGCCGAGGTGCTGCGGAGCGGCGCGGCCGAGGCTGCCGAGGCGCCTGAGGTGGTGCCGGCACCGCGCCTGCCGAAGCTGTCGGTGAAGGAGCAGGCG
CCGGTCAAGCTGGTGTCGCTGACGAAGCGCCGCGAGGAGGACCGAGAGGCCACGGACGTCGAGCGCCTGTGTGTCAAGTCATTCAACGTGCGGCGCCGCC
ACGCGCTGAAGCGGCACAGCCACCACAGCCGGTAG