Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.30
Orientation:
(+)
Number of Exons:
1
Description :
Phosphatidylinositide phosphatase SAC1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Synaptojanin, N-terminal55.602PS50275
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
705-733
1-681
682-704
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
phosphoric ester hydrolase activityGO:0042578IEA
*** None ***
Cluster Id
1916
Sequence
        2202 bases(100 bases per row)
ATGTTCAAGGTGCACCCGCAGGGCAGCGAGCTGGTGCTGGAGGACTGCCGCGCCGGCGCGAGCTGTCCGTGGCTGCGCGTGTCCCCGAGCGGCGCTGACG
TGGCGCTCGAGCGGCTGAGCGGCCCGCCCGCGGCCGTCGCGGATGGCTNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCCCGTGCACGCCGTGTACGGCGT
GTACTCACTGCTGAGCGGACCGCACGTGGCGGTCGTGACGGACTCGCGCGTGGTCGGGTCCGGGCCGAATTCGGAGAAGATCTACTGCATTTTGGCGCTC
GAGCTCGTGCCCGTGTCAGCGGCGGCGCACCGGTCGTTCTTCCAGCACGCGTCGTCCCGCGAGCAGAAGGACGAGCGCGCGTACGTGCGCATGCTGACGG
ACGTGGTGGCGAGCCGCACGTTCTACTTCTCGTACGACTTTGACCTGACGCTGTCGGCGCAGCGGCGGTTCACGACCACGTCGGCGTCCGCGAGCGCCAA
GCCGCTGCCGCTGTACGCCAAGGCCGAGGAGGACTTCTTCTGGAACAAGCCCGTGCTCGGCAAGTTCATCGAGGCGGAGCTGAGCGACTGGGTCATCCCC
GTCATCTCGGGGTTCGTCAAGGTCATGAAGAAGTGCGAGATCAGCGGCCAGCGGTGCGACCTGCTCTTCTTCACGCGGCGCAGCTGGCGGCGCGTCGGTA
CGCGATTCAACGTGCGCGGCGTCGACAAGGACGGCGACGTGGCCAACTTCGCCGAGACGGAGGTGGTGGTGGTCAAGCCCGACCGCGCCGTCTGCTCGTA
CGTGCAGATCCGCGGCAGCATCCCGCTGTACTGGGACCAGCTCGCCACGCTCAAGTACATGCCGCGCACGCGGTACGCCTTCTCGGGCCACGAGAGCATC
GTCGACTGGAACGAGCTCGCCTTCCGCGCGCACATGGACAAGATCATCCAGCGGTACGGCCACATCACGGTCGTCAACCTCATCGACCGCGCCGGCAAGA
GCAGCACGGTGCGCGACCAGGCGCAGCTCGGCACCGCCTACGGCAAGTACGTCAAAAAGTACAATGCTCAGTCGCGCGCGTCGGACGCCATGTCGGTCTC
GTCCGTGGCCTCGTCCGCGTACGTCGTGTCCCCGAAGCACAAGACGTTCGGCAGCTCGAACAGCCTCCCGATCAATAACAGCGCTCCGGCTGGAACCAGC
GGCAGCGTCAACGGTTCGACTGTCGGTTCTCCCACGAGCGTCTCGTCCGGTAGCAGCAACGCGAACGCGGGGACTTCGACGAACGCGAACGGCGGGGTGA
TCTCACTGCTGTCGTCGTTGTCGATGCCATCGAGCAGCAACCCGTCGCCCCCGCCGTCGTCCACGGTGCTCTCACAGCTCTTCGCCGAGCCGATTGCCTA
CGTCTGGTTCGACTTCCATCACGAGTGCCGCAAGATGCAGTGGCACAACTTGTCCAAGCTGCTTGCCGAGGTGGGGGACCAGTTCTCGCAGTACGGCTGG
TTCGAGTGCGACGGCGAGGGCCGGCTGATCTCGCGCCAACGCGGCGTGTTCCGCGTCAACTGCATGGACAACTTGGACCGCACGAACGTCGTCATGAGTC
TGTTCGCGCGCCGGTGCACGCTGAAGGCGCTGGGACTCTACCGCGAGGACGACGGCGGCAGCGTTCTCGACTCGCCGTTCGAGAACTTCGAGCTGGTGTT
CAAGAACGCGTGGGCCGACAACGCCGACTACGTGAGCAAGATGTACGCGGGCACTGGTGCGCTCAAGACAGACTTCACTCGCACGGGGAAGCGCACGCTG
GCCGGCGCGCTGCAGGACGGCGTCAACTCGGTCACGCGCTACTACCTGAACAACTTTTGCGACGGCGTGCGCCAGGACGCGTGCGACCTGCTCGTGGGCA
ACTTCGTACCGGACAAGCGCGACGAATCGCCGTTCACGTTCCAGCAGCAGCACAGTCTCACGCATTTCCTGCTCGAGCTCGGACTCGCGAGTCTCTTCAT
GGTTAGCGTGTCCGTGAGCCTCGCGGGACCGGACGAGCCTGTGGCCGCGCGCGCACGCAGCGGACTGCTCGTCTCGGCGCTCGTCTTCATTGTCACGGGG
TACCTGGTGCTCAAGAAGGGGAAGTTCCGCGTGCTCGGCCGGCGGTACGTGTGCAAACCCGCCTTTTGCTCGAGCGGCTACATCAAGCGCAAGGACAGCT
AG