Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.3
Orientation:
(+)
Number of Exons:
8
Description :
Possible MAPK
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HECT26.388PS50237
HmmSmart predictionP-Valprediction_id
HECT2.7SM00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ubiquitin-protein transferase activityGO:0004842IEA
*** None ***
*** None ***
Sequence
        6483 bases(100 bases per row)
ATGGCGGACGAGGAGACCTCGCCGCTCGCGGATGCCGCGCGGCGGCTGCGCGCGCTGGTGGGCGGTGCGCGTGCCCAGCAGCTGTACGAGGCGCTGGGGC
GACACGCGGCGGACGCAGCGACGGGCGGCACGATCTTCTTGGCTGGTGCGACTGCCGCGCAGCTCGTGCAGCGCGCTCTTCACATCCATGCGGCCACACG
AGTGCTGCCGCACGCGGTCGGCGCGCTAGCCGTGGGCAGCTCGTCCGTCGCGGCGCTGCACTTCGCGTCACTCCCCCGCGAGGTCTTCGACCAGCTGGCC
GCTGAGCGTGCCAAGCTTGAGGTCGAGTCGTCGTGGTGGCGCTGGCTGACTGGCGCCGAGGTACCGTCTCGGTCGGCTGCCGCGCGTACTAGCGAGCTTG
TCCGCGCGCGGATCGAAGACCTCGCGGACGCGCCGTACCCGGCGTACATGGTGATGGGTCTGGTAAGCTTCGTGATGCTCGGTGGACGGCTGAGCGCGTT
GGCTCCCAGTTTCTTTGCGGACCTCGGCGCGTTCCACCTGAAGAAGGCGTCGCTGCCGGCCACAGTCGAGTACGCGACATCAATCGAGCGCGGAGTGATC
CAGGAGTTCGGGAGGCTGTACGGGTGCCACACGTGCGGTATCAAGCGCGGTGTTCGTTTCCACGCCGACCACCAGCCGCCAAAGAAGTGAGTCACCAGCT
CGCCGACTTGCCTGGCGTCGGCTTCCGCGTTCTAATCACAATGGTGTGCGCGCAGAGTCGCGAGCCTTCGTGACAGTCAGCTCCTCCGCAGACTGACTGG
ACGCCAAACGGCCTTCCGATTTTATCCTCAGTGCGAGCCATGCTCGAACCAACAGGCGCATGTCGTCAAGCAGGCAACGACGACGTTGCGGACGCACTTG
CGCGCTCTCCGACTCTACCACTCGACTGGAGTGTGGCTCGTGCTCCTCTGCACTGGCGGGCTGTATGTCGGGGGTTCCAGTTTTCACGGTACACTTTTCA
GCAGCGAATGTTACGAGTGTTCTCGTACTAACGGTGGCAACCATGCTGGGCGTAGAAACCTCGGATGTTGCGTTCACTGGGGCGGCAATCGATGCAAACT
CAGGCGAGCCAAGCGCGGACACTCGAAAAGCTCAATCGGCGACGGCGTTCTCGGTTTTGACATCACTACGAGAGCGAGAGCGTGAGTTGCGGAAGCAGCG
GCGACAGATTGCTGATCCGTCCAACGTTGCTGATATTGACAAGGAGCTTGACGCGATCGAGGCGTGCAAAACAGCGACCAAGGCCAACAACAAACGCTGA
TATCGCCGCAGTATGGCGCGAGGTCGTTGACAAGATGGACTCGAGTTCCGTAGATGATCAGATCGAACGTTTGCTCGTGCCACGAAGCAACTGTTGAAGA
AATAGTGTGAAAGTGTGAAGAGTCTCGTCGACAAATCGTGCTATTTCAGTTGCGGCCGACTCCTTGCTTAAACCAAGGGGGAACGGGTGCTCGCGGCGGA
TAACGGGCATGGCGACAGCTCAGCGCGAGGAGCTTGCGCGGAGCTACCTGGCTCAAGCCTCGGCGCTGCGCTCGGGACGGCAGCCCACGAAGCACGAATC
GAGCCCGCCGCGATCCCATCGACAGAAGCATGGTCCTCGCCGACTGCGACCTGTGCAGCCCAGTGAGGAGGCACTGCAGCAGCGCGAGCAGGGTTGGAAT
GGCCGATTCTTTTACGAGCCGCCGATCAACTCCAACAAGCTGCCTCGACCCGATCGGGATGAGTCGTCTAACCACCACAGTCCAGTAGCCAAGGAACGAA
AGATTCGAGAGGAACGCGCGCAATACGGTGCGGAACACTGCAGGCAAGCGTGTATGTGCGTGGTACATATCTGAATATTGAAAACGCCATGGCTGTCCTA
GGCAAGGGGGATACGAAGCGAAAGGCTGGCAGCAAACAGAAACCCAACAACTCTAAACTTGTTCCGCTGGGATCGCTGGTCCACCCGCCGTCGGTAAGTA
CTTTTACATCCCATAACACTGCTGAGATGAGTTGCGCCTAAATCAGCATGCCGACGACGGAGAAGGAGACGACAGACTCGACCAAGGAAGAGAAGCTGCG
GTTCAAAGTGCTCAAGATTATCGACGCTCGCGAGACATTGCTCTATCAGCTCAGTGCGCTGATTTTGTGCACGCCAGTGCAAGAGTCACTATTTATGCCG
TCGCGACCGACAGAACCACCTCGCAGCATGGGATCTGGTCGGCAGCAAATTCGTCCGAAGGCAGGAATGGCTCTCGCCCCCACGCCGATCGCTGGCAAGA
GTGGCGGCGCGATGACGAACGCCCGAGAAGCGACAAAGTTGGCACAGAAACTGGCGACGGACCTCCAGGAAGTGGGCATTCAGTGCGTCGAATCCTTGGT
GGAGTGGATGCTCGAGGCAGGTGCAAAAGCGGAGTACGTTGTGCTGCTTGAGTGGCATGCATTGCTTACTGGGATTGCTTATGTAACGAGTGATGCCAAC
GACTGTTGATGTGTATGTGTGCAATTCAACAGGAAACCACCTCCATTTCTCTGGCGGGGTCGCAACTACTTTTTGAAAATGAACAGCGACCTAGACTTTG
CCGAGGCAGAACTGCAGGCGCGCGGCGTGCATCTTGACTGCTTTTCGTCCAAGAACCCCTTGCTGATACGACCGAGTCAGAAGCTGGGACGTGTGCTGGC
AGCGCAGTCCATCATCAACGAAATGATCGAAATGAACAAGGAACCGACACCTCAGGAGATCGTCGCACTCTCGTCGCCAGATCAGCGCGATGGTAACACA
GATCGAGATGGCACAGAGCTGACGCGGGTGAACGACAAGCCAGGAATGTCCGCTCCAGAGCACATGGACTCGTGCACTCGCTCTGATGTACTGCTGAAGG
TCGATCGAGATGAACATAGCGACGGGAAAGTCAATGACGCCAGCGGGTCGGTTGATTCTCAAGACGATGATGGATATGACGAAGATCAAATGAGTTCCGT
TGACAACAATGATGATAATGGCAACTTGTCCGCTGGTGTGCTTATTCGAGATCCAGAAACAGAGGTGGAGCTGGTGAGCATGCTAGACGAGAGTCTGAGT
GACCTCGCGCATTTTCACTCTCGCATTTACGATGAAGCAGCCGACAGGACCATCAATAGCGCTCGGACAGACACAAGCAACCAGTCTGAATACAACGACA
ACAACTTCGACGACGAAGACAGCACTGGTGAATACGCCAATGAGTTTGGCGCTCGCGATGGCGGTCCAGACGGAGCCAAAGCGTACGCTGTGACAACCGC
TGACCTACAGGACGATGACGAGGAGAACGACGACAAATCGACGCCTGAAGAAGCGTCACTCCGTTCAAATGCGTACGAGGAACCTCAATCAGAGCAATCA
GCGGAACCGACAACTATTTTTCACAGCGAAGAACCCGACTCGATCTCTCCTATCTGCTGTCCTCCCTCCAGTGAGATCACAGCGCCAGGTGATTCTGTTC
ACACTAATTCCGAAGGCAAATTCCATCCGCAGGATCCGACAACGTTTCTTGCGGATGAGTTTTCCGAACCCCAGCAAGGTACATCAAGCGAGACCTTGAT
TTCTACCCCCGTTCAGGCCGAGATCGAGAAACCCGACACGTATAGCGCCGGCGTTGAGTTGTATTCTGGAATGTTGGCTGACGATTCAGACGCCGAGTTG
TCATTGAGCGGCACTTGTGATCCATTGTCAAATCCACCTGCTCCGCAAGTGCTACTGGACGAACTCGAGAAATGGGCACCAGAGTCAGAAGCAAGAGAGG
CGATTGCTTCGTTGCCAGAGTCCTTCGTGTGGCAAGATGCCGAAGCATTGGAGTCATCTATGCGTGACCACGCGTCGTTAGTGCCATCCCTGCAGAGTTC
CCTCACGTGGGTTCTCGCTCATTGTCAATTGATCCCCCCGAGCTCGCCTTTGGTTGGATTTCTGAGCAGCAGTGCCGCTGAATCGCTCGCTGTTCGACTG
CTTCTTTGGAACGAGTGCAGTCATGTGTTGAGCATCGTGTGTCGAGTCCTGGCGTCTCAAGTGTTAAAAGCACTTGAGAAGGAGAACCCACTCGTTTCCG
AAATCGACATGGGCGACGTGGTAGAAATGGCCGAGGCAGTCTTCCGCAGCCACGACGACAGCGTGTGGAGGTATATTGGGGTCGTGACCAGCTTGCTGTG
CTTGCCAGAATTGACAGATGCTGTTAACTGCAGCGAGACTTCCGGTGTCAATTCTTCGGCAGGCAAATGTGGCTGTCCTGGTCTATCCGAGCTGGTTCAG
GTGTTCTACCCATATCTAATCAACCAGCCGCGAGACAAGCTTCGTGATCAGTGGCGAGTACTGACGCACCTACTCACCCGCCATTCGTTGCGTCTTGATA
AGTTGGCGTTTCTGCTCGATCCTGTATTGAAGGGACTCGTGCTGGTGGTATCTAGCTTAGATGTGAGAGCTGGTGGCAGCAGTAGCAGATCAATCGACGA
TTCGGACCGAGATGCTCTATCAATTCCAAAACTCGCTATTGTCTGCGAGCGCGACGACATTTTGCGCTCAAGTATAGACGCTGTCTGGACGAAGCATCTC
TCATCGAAGGACGCACCGCAACATGTCATGTTGTATCCGTTTTTCAGATCGCCTTACGGGGAGAAGGTGGTTGACAACGTCAAAGTAGAGGAAGGAGAGG
GCAAAGGACCTCTCAAAGAATGGTTTGCACTGGTCGGAGAGAACCTTGCTGCGAAGTGGAGACAGATTGAAGTCGATCTCTCGTTTGCCAGGGACTCTGC
AGACGGTGATATCGTTGCAAATGGCAACAGACTCGTATTACCGCATTCAGTGTCGCACCTGATTCGGCCCGGGTTCCAAGTTGAGTGGGAGGACAGCATG
AACGTCGGCGAGACGGTTGTTAGAGTTGTCAACAAGGAAGATCCTGTCTCGCGCGACACTTTCTTGCTGGATCGAGCGGTGTCGTCCCAGTCGTTTCCTG
TATCTACGCTTCGGCTTGCCGAGCCCTGCACTCCGATCTTCGATTACATTCGAGCCTCAGAGAGCTACAGTCTGAACGCTCTGACGGCTGATACTGCTGA
GAATCGTCGGACGTTCACGTTCGTGGGCTGGTTGCTTGCTACCACCATCACCCACAGCTGTACTATTCGTCTGCGGCTGCACCACCTCATCTTCTCATTG
TTGCTGAATCCCGACTACCGTGTAACGCTGCGTGACCTCGAGGAGTTCGACCCTGTGCTGCGCAAGTCGTTGGAGCAGATTAAGACCATGCCGAAGACGG
ACTTGGCTGCGTTGCTCGAGCTCGAAGAAGTCAACCCTTCCTTCACGGCAGAGGAGTATATTTCGCACACACTGGAGTCGACATTCGGATCGAGTTCTAG
TCTGGCGTGGCAACTGGATGCCATTCGTCAGGGGTTCGAAAGGGTCATTTCGGTTGGAGTGGCCAGACGACTGGGTCTTAGCGGGAGAGATATGGCAGCG
CTAGTATGTGGCGACAGCTGCAGCACTGACGTCAGCGATAGCACCGATTTCCAGATTGATCTAGTGTTCCGAGTCGCAGCAGATCCTGACTTTGCTGCGT
GTGCTCCGCTCAGCCGTGGTTTCTGGCGGACAGTGAGCAAATTCGATCCGTCGCTGAAGCGGAAGCTTGTCAAATTTATAACTGGCGTCGACACGTTGCC
AGTGCCAGGCACTGAGGTAAGATCATCGTCTCGCTTCCAGTGTTTTGCTCGTATTTGACTGGGTGAGTTGGTACATGTTATCAGTTTCTCCGCATCGAGA
TGCCATTTCCGGCCCTATCAGCCGCCGATCATGCCAAGAGCTTGCACATGTTGCCCCAAGCTCATGTACGTCAGCTCCACAGTGGTCTCGCAATCGTTGG
TGTTGGCCGAGTTGGGTTGTGTTCTAATGTTCGTATACATCCTTTTAACATGCAGACCTGCGACAACACCATCGAGCTGCCGCACTACTGGAAGGCTCTA
TGCTGGCACCGCCACCACGACGAGCACATGGCCACTGACGAGGCAGAGGCAGCGCTTGAAGAGCTGCTTGAGGTGAAGCTCCGGACTGCGATCGAGTGTT
CCGAAGGATACGGTTTGGACGGCACGGTCGCCGTTGCGGGGATTATTCCGGGAACAACTCGTGACCCATATGGAGGTGACAACGGCGGCGACAAGGAAGA
AAGCTACGAGTCACTGGATGTCCCAGCGCTGCAGAGCGGCGATGGCACGCGCGAGGATTGTACGCCGGAGACGAACGTTCATGAAAAGCTGCTCGCGCTA
TCTGGTTCAGGCGACGCAGTAACAAGAGCGGGCGACGAAGGATCCGACAAGCCGCCGAGCCCGTTATGGCCGCTATTGTCGTCATCCCTCGGAGAAGGTA
GCCAACGAGAAGGGATTGCGTCTCCGGGTGGCCACGAGGAGTCGTACGAGGAGAACGACTGGGAAGACGAGGAGATGGCTTGA