Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.39
Orientation:
(+)
Number of Exons:
2
Description :
Protein T20G5.9, partially confirmed by transcript evidence
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-249
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        760 bases(100 bases per row)
ATGGCAGCTCGAGGTGGCGGACGCGGCGGCGCCGCAGCGGAGCAGCTCCCGCTCGGCGCCGTGCGCACGGAGGACGGACAGGTGGTGATCCCGGCGTCCA
CGCGCGCGGACGGGTCGACGCGCAAGGCGATCCGCATCCGCCAGGGCTACGTGCCGCAGGACGAGATCGCGGCGTACAAGACGCCGGCGCAGCGGGTACA
CGCTTTCCCCCCAATGCAAGCGCTTGCGTTATTCCGTCCAACTGACGTCTTGAGTGTATGTGTAGCGGCGGGAAGAGGAACAGCGGCGACGTACCGTGAA
GCAGCCGGAGGACGGAGGCGACGAGCTGTCGTTGGGCTCTCTCTCGCTCCAGGATGCGCCGCCTCGCCAGCAACGACCTGCCTCGTCAGCGAGTGCTCGT
GCCAAGCCTGCCAACGCTGAGCGCCAGGCGAGCAGATCACCGCGATCCGCGCCATCGACCGAAGGAAAGAGCGCCGCTGCACGTGGCGAGCGAGGCTCGA
CCAAGCAACGGGACGGGGACGACAGACAAGCGCAGCTCAAAAAGGACATCACGAGGATCAATCGGCTGCTCAAGGACATCGCCAAGCTCGAGGCAGGCTC
ACAGGACGAGCTGTCGGACGCGCAGCAGAAGAAGGTCGCTCGGAAACAGGAGCTGCAGCGCGAAAAGAACGACATCATCGCCGAGCTGAACGGCGCGACT
GTCGACCGCACCGATGACGGTGCTGGCAAAAAGAGCCGATTCTGCGCCATCAGCCTATAG