Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.6
Orientation:
(+)
Number of Exons:
2
Description :
Dicarboxylate/amino acid:cation
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
TRAM/LAG1/CLN8 homology domain11.235PS50922
HmmSmart predictionP-Valprediction_id
TRAM/LAG1/CLN8 homology domain1.1SM00724
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
KO ID
K04710
*** None ***
Sequence
        1078 bases(100 bases per row)
ATGCCGTGCTTCTTCCGCGAGTGCGAGCCGACGGCGGAGCTGCGGCGCTTCGCGACGGCCTTCGCGGGCGTCTACGCCTACCACTTCGTGGTCGACAAGC
TCATCATCTCGCCCTTCACGGACTGGCTCGTGCGCTCGAAGCGGCTGAAGAAGGACCGGCGCGACAAGTGCCGTGAGTCGCTGTACAAGAACGCGGCGGT
CGGCGCGTTCTTCGCGCTGGGGCTGTCCATCGGGTGGGGCCACGACTGGTTCTTCAACCCGAAGGGCTACTTCGTCGAGTTCCCGTGGGACGCCCCCGAG
GAGCTGCGCTGGTACTACATGATCTACCTGAGCTTCTGGTTCCAGAGCGTCGACTTCATGCTCAACCTGACCAACAACCACTACAAGGTCAAGCGCAAGG
ACAACGCCGAGATGCTCGTGCACCACTTCGCCACCATCGCGCTCATGGTCTTCTCCTATTACTTTGACCTCACGCGCGTCGGCATCTGCGTGCTCATGCT
CCACGACGTCAACGACCTGCTGCTTGAGACCGGTGCGTTGGTTATTTGGTGTGCGCTTTGCCGCGGTGGACATGCTGGAAGCTGACCGCTTTGTCGCTTG
TCTCTTGGACACTTTTGTGTTGTACGATGCAGCCAAGTTCTTTGTGTACCTGGAGGAGGAGACGATCGCCAACATCTTCTTTGGACTCTTTGCGCTCGTC
TGGTTCGTCGTGCGCTGGTTCGTCTACGCGCACAACATCCTGCGCAGCGTGTACTACGAGGCGTACGAGTCGATCATCGTGCGCATCCAGGCGGAGGGCG
TGTTCTACGGCATCGACGCCACCGTCTGGTACTACGTCTGGTGCGGCTTCTTCGCCTTCCTCTCGCTGCTGCTCGTGCTGCACATCTACTGGGGCGTGCT
CATCGTCAAGATGGTGTCCAAGGCGCTGAACTCCGGCAACGTGGAGAAGGACATTCGCAGCGACTCGGAGAGCGAGGAGGACGAGGAGGAGGTGGTGAAG
CAGCCCAAGGCGCAGGCCGAGAGTGCCGAGCCAGTGGACGGCAAGCCGAAGCGCCGCCGCGCTCCCAAGGCCGAGTAA