Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.53
Orientation:
(-)
Number of Exons:
6
Description :
Nucleoporin Nup43
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
WD40 repeat9.3SM00320
WD40 repeat1.1SM00320
WD40 repeat1.6SM00320
WD40 repeat390SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-353
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
1915
Sequence
        1623 bases(100 bases per row)
ATGAGCCGCGCATCGACGCACTTTGTCGGCGAGAAGGTCGGCGCGCTGAGCGTCGCGAGCGGCGCGCGGTCGGGCGGCTCGAGCGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCGCTCGTGGCGACCGGCGGGTGGGACAACCAGGTGCGGTATGCAGCAGCGTGCAGCGGCGTCACTCGTATCTCCTGAACCCGCA
TCCTAACACACTTTCTGTCCCAACCTGCTCAGACCAACCACGTGGCGCTGCACGTGCCGGTGCTGCCCTCGCTGGACGAGCGTTCGCTGCACGACGAGTT
CCGGTGAGATCCCGTTGCTCCCCCTCCTGTCGTGTGTCGCCTAACTAAAGCTGATGGCATTGATATCAACTCAGAGCCAAGTCCAGCGCGCAAGTGAGCG
ACCTCGCGACGCTCGCCGAGGCGCCGCATGAAGGCGACGTGGCGGCGCTGCAGTTCGTCGGCGCGGGCGACGCGCTGCTGCTGCTGAGCGCGTCGTCGGC
GGGCGGCGTGCGTGTCTTCCGCGTCCGCGACGAGGAGCGTCCGGCGCTCGAGGTCGTGTCCTCTCCGCAGTGGGAGACGCTCTTCCGCGGCTACGGCGCG
ACCGGTCTGGACGCGGTCGAAGGCTGCTCGAGCGTCGTGAGTGTGAGTGGGGGCGGCGTCATCGCGTGGCTGTCGCTCGACGAGCAAATGAGCGTCACCA
CGATCGGTATGGCTGTCTGTATGCGACGTGTGAGGAAATGTGGATCTCACAGCCATGGCTGAACGTGTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
GTAGAGAACAAGGACGCGTCTCGGCTGGCGCTCAACGCGGTCAAGCTGCTCGGGAGTGGCTCGGTGGCTGCCACTGCCGGGTGCGTCCACGTCCGCTTGT
CGCCATTGTGGGAGTTCGAGGTGTTAACGCTGTGATGAGGGACGAGCAGGTCGGCACCGGGGAGCCAGCTTCGCATTTGGGACATCGCAGCCAACAACCA
GTTCCCAGTCGCCGTCGCCAGCGAGTACGCAGCGTTCACACCTGGGTTGGGCGAGTACGTCGATACTGACACTGTTATGATCGTAGCCCCAAGTCCGGCG
CCGCGCTCACGGCCGTCGAGACCCACCCTACGCGACCCGAGCTGCTCGTGACCGGCGCCGACGACGGCCGCGTCTGCTTGTGGGACCGCCGGCGCCTGGA
CGCTCCGTTCCGCACCGAGACGAGGCATGCGCGTGCCGGTACGTTCTACATTGCTGCATTGCATCAGACTATTCGCCTGACAATGCTGGTGTTGCCGCAG
TCCGCGCTGTCAAGCTGCACGCAGCGTCGCCGCGGTTCCTCTTCTCGGCGGGCGACGACGCCGTCGTGCGTCGCTGGGACTTCCATCACGAGCGGCGCGA
CCGGGACGCTGTCGAGTACGAGCGCCGGTCGAGCGCCGGTCTCGCGCTGTCGACTGCGAACGGGTTCGGCGGTCACGGCGACGACGGACTGCGCGTGGAG
ACCGTGGCGAAGAGCGATCTGCCGTGGAACGCACTGGCCGTCCACGCCGAGAGCGACACGGTGGTCGCCGGCTCGGACGCGCAGTCGGTGGTGCTGATCC
AGAACGCGTCGAAGCGGGAATGA