Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.23
Orientation:
(-)
Number of Exons:
6
Description :
Zgc:66176
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
RNA (C5-cytosine) methyltransferase2.1PR02008
RNA (C5-cytosine) methyltransferase2.1PR02008
RNA (C5-cytosine) methyltransferase2.1PR02008
RNA (C5-cytosine) methyltransferase2.1PR02008
RNA (C5-cytosine) methyltransferase2.1PR02008
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA (C5-cytosine) methyltransferaseIPR023267
Y-scoreD-scoreY-pos
0.620.74725
InsideOutsideTMhelix
1-714
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3764
Sequence
        2579 bases(100 bases per row)
ATGGCGCTGTTCCGGCGTCTCCTGCTCTTCGTACTATCTGCCGTCGCCACCCTCCCGAGCTGCGCGACGGGCGTGACTTGGTCGGAGCGTGGCGCTCTCG
AACTGTTGTTCTGGGCGACGGATGGACGAAACTGGCTGCACTTGTGGGACATCCATGATGAACGGAGCGACCCGTGTCTCGACAACGTACGTGCTGCAAC
AAACAATGATGCATTGATTGGAACACGCATGTGTATGTTTCTCCCTCGTCTGAGTGAACAGTGGTTCGGTATCGTCTGCGACCGCCACGGACGCGTTCGA
GCCATGTGAGCACTGCAATGTGTGATCTGTCCATCAAGAGTGGCATGGTTCACACTTGCTAGCAACAATTGCTGCAACAGACGTCTGCCCAACAACCACC
TCGTGGGGTTCCTACCGCCAGAATTCGGCAGAGCCAGTCTGTCGGGCTTGCAAGAGCTGTAAGTGCATGTCTGGATCAACATGTCGAAAATGTCTGGAAC
TAATGCAAGCATGCATGTGCAGGGATCTAAGCTCCAATTACTTGACAGGGTCGGTTCCCGACTCTTTATCCAACTTCGCGGTGCTCAGGTCGCTCCGTCT
CGACGGCAACGTCTTCACTGGGACGGTGCCCAGCACCTTGGGGTCTCTCCAGTACCTTGAGTTCCTGTGAGTGATCTCACCAATTTCGTATCTCGCTCTT
GATCAAGCGCCACCAATTGACTGGTTTCTCTATCCCTGCATCAGGTCTCTCCAAGGCAACCAATTCGACCCGGTGGACAGTGCAACTGGCGCGATGCTCC
CCGCTGAGGTGGTGCAGCTCGGACGAATCGTCGGTCTTCGTCGCTGCCGCATTTCGATCTGAGTGTACCCATATCCCACCTCTTCCAGTTCTAAAATGCA
ACATATTTGCAGTAGCCATCTATTCGACATATGTTGTGTCATCCGCCAACCAGCTTCCAGCCATTCCAGACCCGACCTGCAACATGAGCGAGCTGTACAA
GGAGGCCGCCGCGCTGCTGCAGAAGCTCGAGCGGCGCCAGGGCGGACTCAAGAGCCTGGCGTACGCCGACGACGTGGCGCACAAGCGCAGCTCCTTCGCG
CTGGTGTGCGAGACGTTGCGGCACAAGCCGCTGCTGCGCGAGCTGGTGCAAGCCGTGCCGCAGTTCAAGCTGCCCAACAAGCTCAAGGACGCAGGCGCTG
CAGGCACGCCGCTGCTTTACATCTCTCTGTACGACCTTCTCTTCGGCCGCGGCAAGATCCAGGGCGGCGGCCATGTCAAGAAGGAGCTCATGAAGCACCA
CAACGCCTTCCGCGCGGCGCTGGTTCGCATGAAGATCAAGGCCAAGGTCGCCTCGAACGAGGACTTGTTGCCCGAAGAGAACCGCAAGCACGCGGGTGCG
CTGCCACGTTATGTGCGCGTGAACACGATACTGGCCTCAGCCGAGGAGGTCGCGGCGTTCAAACAGGAGTTCGCCAGCAGCATCAAGGAAGACCGCGACG
TGCGCGACTTGCTGGTGCTCCCGCCAGGCACGGAGCTTCACGAACACGAGCTCGTCAAGAGCGGCAAGCTTGTCCTGCAGGATAAGGCCAGTTGCTTCCC
AGCGTTCGTGTTGCACGGCGAGCATCGCGACGCAAGCGACCGGGCCGGCGATGTGATCGATGCGTGTGCCGCGCCGGGGAACAAGACGAGCCACGTCGCG
ATGCTGCTCCATCAGCAAGACTCGAAAAAATCGACCAAACGGCGAGTGTTCGCGTTCGACCGCTCGGCTAAGCGACTGGATCTGCTCAAGCGCCGCATGA
AGCTCGCCGGCGCAGCTGACATCGTCGAGCCGTGTCTCCAGAGCTTTCTGGAGGTGGACCCTGACGACGACAAATACCGTGGAGTGCGCAGTATCCTGCT
GGACCCGTCGTGTTCCGGATCGGGAATGAACAACCGACTTGACCACCTGCTAGACATTGCCAGTTCGCGCGACAAGGCGCTGGAACCCGGCATGGACGAA
TACGAAGAAGATGTGGCCAACCGCCTGCAGTCGCTCGCCGACTTCCAGCTGGAGGCGCTACTCAAGGCGTTCTCGTTCCCGCAGGTCGAGCGTGTTGTGT
ACTCGACGTGCTCCATTTTCCAAAAGGAGAATGAAGACGTGGTCGTCGCTGCTCTCGAGTCGCCAGCAAACCGCGAGGCGAGTCGGCCATTCCAGCTGCG
ACCATGCCTATCGACGTGGTCGCGTCGGGGAGTTGAAGTTCCCGCGCTCAGTGTGGATCAGTCGAAGTCGCTGGTCCGCGCCAACGGGCTTGAGGATGAG
ACTAACGGGTTCTTCGTCGCCTACTTCGAACGAACTGCCGCCACCGCAGCGTCGACGGTCCGAGATTCCAGCAAGAAGGTGGCTGTTCAAAGCGAACTCA
ATACTGCCAGCGTGACTGACACGACGGAGACCGAGGCTGCAGTTCCAGCAGAGGAGATAGCAACGGGGAGCAAGCGGAAGCACTTATCAGCTGCTCAACG
CGAGAACAGGAAGAAGCGGAAGCGTGAGAAGCGCAAGCAGAAGCGGCACGATGGTGAACCGACTGATCAGAAGGCTTAA