Transcript Name :
Pytve_DAOMBR484snap_masked-pve_contig_1-abinit-gene-1.84
Orientation:
(-)
Number of Exons:
6
Description :
YALI0F03300p
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-242
NN-scoreoddsWeighted Score
0.6621.7390.003
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
Cluster Id
1914
Sequence
        1049 bases(100 bases per row)
ATGGAGACGTTGACAATGCTGAGAGTGTGTGGTGTTGACTCGGACAGGTGATGTTCGTCGGCACCTTGTCGGGAGGCTCGTCCTTCAGCTCGGCGCCGAC
CCCTGCGCCGCGTGCGACGAGCTACGCGGCCGCGGACGGCCTCGGCATCAGTGTGCTCGACGATGAGGATCGCGAGATGCTGCCGGGCGAGATGCAGGCC
ATGGAGGTCGAGGAGCAGGTGCGTATGGAGTAGTGTGCGGTTCAGCACGTGCCGCTTTCTGGATGGAGACTCACACTGGATGTGTGTGTGTGTGTATCCC
GTTGACAGTGGCCGCCCGTCGTCAAGTCGGTCATGGAGCCGATGAGCCTTCCAATCGCGCGGAAGCCCGAGCCGCGGCACACTGGCGGCGTCTTCTGCGA
TGAGGTGAGTCGTGACCCTCACTTTGTGGGTTGGTTGATCTGCTCTAACCAGGCGCTGGCAACACCCGATAGAATGGCCAGTTCACGCTGGCGGACGACT
CGCTGCTGTACCTGCAGTTCCCCACGACGCTGCCGCTCGCGACGGCTCCGTCTACGGCCGCCAAGGACGACGAGGACGACAAGATGGACGGGAGCGCTGC
CGCTCGGCCGGAGGCTCGCGCTCAGTCGACCCCGCAAACGGAGGGCTCCATCAAGTTTGCGTATGTTATCGTGTCTTGTGTCACTGTGATGATCAGATCC
AGAATCTCACTTGCGTGTTTTCCGATCAGCACCGGCGAGCGCTTCGACGGCTCGATCTCGACGGCACCTGGCGGGTTCATCGGCAAGGTGCGACTTGATC
GGAACTGCCTTGTACTCATCCATTCTTCCTGGTCTGACGATCGACCTGTGGCCGCAGCTGTGCATCCACAAGTCGGGCAAGACGGTGCTCGTGATCGGCG
ACAAGCGCTTCGACGTGGCTGCGTCTCAGACCTCGTCCATCTGCGAGGACGTCTACTCGATCAACCACACGGAGCAGCAGCTGTACCAGCTCGGCGCCGT
CGAGCGCCACCTGGTCGTCACTCCCGACTTCGACGCGCTGCTCGGCTAA