Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.74
Orientation:
(-)
Number of Exons:
6
Description :
Voltage-gated Ion Channel (VIC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-85
168-219
271-281
339-349
109-144
239-252
305-318
373-1049
86-108
145-167
220-238
253-270
282-304
319-338
350-372
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K05325
*** None ***
Sequence
        3402 bases(100 bases per row)
ATGCCGAACCGGAACGATGTCGTGCCGCTGTCCCCGTCCGCGACTGACAACGTCGCCGGTCCAGAGGTGGAGGCGGTGGCGGCGACGCACAAGCAGCAGC
AGGCGGCTCAACCGGCTGCGGCCAAGAGGAACAGCGCCACGGTCACCAAGTCGGACGCGTCCAACAAACTGGCGACCAACACCCCGCTGAACGTCGAGAT
GGCCACGAAGCAGGAGCGGCGCGCCAGACTCGTGCACTTGCAGCGGCGCGACACGGCCTTTCAGCTGGTCTACGCGCTCTTCGGACTCGCACTCATGGTC
GTGCAGACTGAGTACCTCTGGTTCGCCAACACGCGGCATCTCTCACTGCCTTGCCACGTCGATAACTCCACGTCGCCCGCATGTCCGCGCTGCCTCGAGT
CGATGAAAGTATCGGTGCCGCAGCAGGACGGCCAGATGATCCTGCACTCGGTGCGCGTGCTGCTGTCCGTCTCGACGCTGCTGCTGCTCTACCACACCTA
CCGCTTCTACGCGAGCGAGGTGGAGGTGATGAAGATCAAGAACATCGTGCCTCCCAAGGCCACGCTGCTGTCCTCGTCGTTGCGGCGGCGACTCGTGCTG
GAGCTCGCGCTGCTGGCCGTGCACCCGTTCCCTGGACTCGAGAGCGTCGACCCGCGCTGGCCGAACCTGCTCGTGGCCTCAAGCCTGCTCATGTTCGTGC
GCATCGGCCTCGCGCTCCGCGTCGTGCAGTTCCGCCACCCGTTCAACTCGAGCAACGGCTGGTTCATCGGCGCGCTCACCAACGTCGACTTCACGGTCGC
CTTCTTCCTCAAGTCGACGCTCAAGAACTACCCGAGTCGGTGCATCCTCGCGGCCTTCGTCGTGCTCGTGGGGGTCGGCAGCTACGCGCTGTTTGTCGTC
GAGCGGTTCCTCTGCGCCTTCGTCCACGGCGCGTGCTGTCAGCCCATGTCGCTCGCCGACGCGCTCTGGACGCTCGTCATCACCATCCTCACGGTCGGTT
ACGGCGACGTCGTACCGCGCACGATCCCTGGTCGCGCGCTCGCCGTCTCCGCCGGCCTCTTCGGCATGCTGTGCACCGCCGCGACCATCGCCGTTATGAG
CCACTACCTCGTGCTCACGCGGTCCGAGCACAAGGTCAACGCGTTCCTCAAGAAGGACGAGAACCGTCAGCTGATCAACGACCACGCCGCGCGGTCCATC
CAGGCGTTCGTCCAGCTTCGCGCCATCCAGCGCCAGTCGCTCCCGAACCAAGCCAACTCTCGAGCACAGTTGACGGTCACCAGACTCGGCAGCAGCTCGA
ACATGGCCGCCGTGTCGCGCGGAGAGAAGCAGTCGCCAGCCACTGCCGCCCGAGAGCTGGGAAAGGCCGAGATCAAGCTCTTCGACGTGCTGCGCGCGTA
CCGGCAGGTGAAGCGCCACGTCAACTCGCAGGACGTGAGCGACCCGATGGACAAGCAGATGACCATGCTCGAGATGATGGAGGTCAACGTCGAGTACATC
CGCACCAAGATCGAGGACCTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGCCGCGCCAACCGGCAGGTCGCCAGTCCAGAGAAGCGCC
GACTCTCGCACTTCATTTCCGCCGTCATGAACAGCTCGTCCTCATCCTCGTCAATCGCGACGACGACCGCAGCGCCACCGCCGTCATCGGCATCTCACCA
CCACACGCCGACTCGCCTGCCGTTCCAACCGGACCATCGCGCGGCACCGGCCACGTCGACGATCCACGAAGACGACGAATGCCGCGAGCAGCCGAGCCAG
CCGCCGCCACGACTGAGCGGCGCATACCTGCACCACCTGCCGGCGCACGACCACTTGTCCTCTGGTCCGTCGGCGATGGCGACGGTGGGGACTCACCAGA
ACGGCTTCCACCAGACGGACGGCGGCATCCCCGAGTGGGCCATCCTGCTCGAGAGTTCGCTGCAGACCATCCTCGGTCAGGTGGCCGAAGTCGCGGCCGA
GGTCGACGCGGTCAAGTCGCGCGTCTACCAGCACATGGACGCCGTGGACGCCAAGCTGCTCGACCTAGAGCGGAAACTCGTGGTGGGCGACGCGCTGCGC
GAGATCGTACGACCCAAGCCGGTTCGCCCGAGTCTCCGGCGCGAGTCGAGTGAATCCAATTTTTCCGCCGCCCTCGATACCGCCTCAGGAGGAGCGAACG
GAGGCGGTGGACAAGGGTCAGGCATGGCGTCAATGTCCTCGAACGGCAGCACGGCCAGCAACACCTCGCTGCCGCGGTTCCGGCGCGTGCCGAGCAGCAG
CAGCAACCGCAACCCGACCATCCAGAGGTTCGTGACTCAAAGGGACCTCGAAGAGTTCCACGGCAACGACGGGATGAACAGATAGTCAGCGGCGACGGCA
TCCATCACCACCACACTCCAGACCGAACGATGGAGCTGGCGTAGTGTTGCTGCCGATTGTCGAGGCCGCCGTCCGCGAGGGATGATGATGATTAAACTTT
AACTTATACTCGCCGCGCAAGGCGACAATGCTCAGACTTCTTCTCAGCAGTGGCACCGCAGCACGCGCTTGTAGGCGCGCAGGTCATCGATGACGTGCGG
CACCTCGTCCTCGCCCACGAGCTGCTCCAGCGGCAGGATAGGGCTCTGCTGACCGACGATGTGGACCCGTAGCAGCTTCCGCTCTCCGTCGTCGCCGTTC
GGACTCGATCCCGACGGCAGGAGCCAGCGGCGATAGCGAGCAACGAGACCGTCGATCGAGCACGCGCCGAGTGCCAAGGCGATCTCGCTCTCGAGAGCGA
AGGCGTAGCGGCGGCACTGGATCTCCTCCCAGTACCGGTCTGTCTCATCCGACAGCGTGGCGTCAGCTCGCGACTTGGACCGCTGGAGCGCGGTCACGTG
GCGAGCGAACGTGCCGTCCAACTCCTCTGCCTTGGGCAACACGTCCGCGAGGTAGGACAGGAACTGGTCCCCCACGAAGCGGTCTATACGCACGGCGATC
TCGCCCGCGGCGTGCGACGCCGACTGCACGGCGATGCTGAACCCCACGACGCCGTGCGTGTCTCGCACGCAGCAGTGCACCTCGTACCCGAGCTGTTGCG
TCGTGCGCAGCTCGTGGAAGAGCGGCTCGGCCATGAGCTGCTGCAGCAGCTCGGCGTACGCGCGGTCCTGCACGTCGAGCTGGCCGAGCTGGAAATACAC
CTCGACCATCGAGTTGGTCTCCTCGGCGTGCTCGCTGACGTCGCGCAGCAGCAGACCGTTCGCCGTGGCGGGAAGCGCGATCGTGCGCGGTCGTGCCGGC
GTCAATGGCGTCGCTGGCTCATACCTCTCCTCCACCTTGAAGCTCGCAGCTCGAGTTGACACCGCGCTCTCGACGTCCAGCAGCAGCTGCTTCGCGTCCT
GA