Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.39
Orientation:
(+)
Number of Exons:
9
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Transcription factor IIS, N-terminal17.221PS51319
HmmSmart predictionP-Valprediction_id
Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type4.9SM00509
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-575
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
nucleusGO:0005634IEA
transcription, DNA-templatedGO:0006351IEA
*** None ***
Cluster Id
2637
Sequence
        2268 bases(100 bases per row)
ATGGCCATGTACACCAAGATGACGGCGACGGGCTCGTCCCTGATCGTGAACCCGCGCACGATATCGAAGGAGCTGGAGACCAAGATCGCGGCGTCGATCG
CCAGCGTCATGGCGACCCACGACGTGGCCAAGCTCTCGACCAAACTCGTGCGCCAGGCGGTCGAGAAGGATGTGCACGTGAGTCTGGCCAACCACAAGGA
GGTGCTCAAGCGACTCATGCACCAGGAGCTGCGCAAGATCAAGGCCAAAAAGGTGGGCGATACTATAGGTCCATGACGTTCCATGTTGGTGGGTTCGGTG
CGCGCTGAAAGGGTTCGTGGACTGCACCTGTAGGCCGCCAAGCGCGTGGTTCCCGAGCCGTGGAAGATCGCAGCGCGGCGCGAGAGCATCGTCAAAGGTG
CGGCACTGAGAGCGGCGCCTGCATTATTTTTCATGACTGATTCTGTCTTGTTGGTCAGCTTTGGCGCGCGTGTACGAGCTGTCGCGCCACACGGACACGA
CCGCGATGCACGCGATTCAGGCGTTATACGATCTGCAGGCTGTCGAGAGCGGACCAGTGCTGCGCCTCTCTGCGCTTTATGCTCGTCTGCTTGGAGCGCG
TTGGTTACGTGAGGATCGTCACGCGGATTGGGTGGTCGGAAGCGTCCCAACCTCCACCCAGGTTGGTCTGAGCTGTATGATTTTGATGCAGATGTTGGAG
TGCCAACGAGCGATCGTCGTGCGCATGTATGCAATAGTTGGTGGAAGCCATCTACTCGGTGTACGTCGTTGAGCGGCTAGGCATTTGCCACCCTCGCCGA
GCCGAGTTGTTGGATCTGCTGGGACGCTCCCCGCCGCATTTCCAACCCCAGGTACAAGTCTCCATGTTCGTGGCTGATCGGAAGATGTGTTCTAACCTGT
ATTTGGTCCATTCCTTTTCTTTTTATGATGTGCAGGATCTGCTCGGGTGGAACCCTGCTGTCAGCGCGCCACCGCCGTCCGATGGTAGTTCGTCCCTGTA
TGAACGTTTCACAGATGCACTGCTGCTCTGGTACTACACCAACTACCTTGGACAAACGACTGGCTACACATTGATTCAGGTACGAGATGGCCAAACACGT
CGAACCCTGCCGATGTATTGACTGACTGCTGGTTGTCGACTACGCTTGCGTTCCCCGACGTGGCAGCTGCTCCAATATCTGCCGATGCTGTATCCATACA
AGAGTCCGACCGAGTTATCTGTGGCGGAATATGGCCACCAACTCAATTTGGTCGTGTCGTTGGTTATGGTGCTCGCCAATTTCGGACGTCTACGATGCGA
ACCGGTGCGTCCGATGCCACTTGTGCAAGAGTGCACTTTGCGTATTGGTTCTTATATTCGTCAATTTGGTCAGGAGCTACTTCCGCACGAGTATTTCTTC
CTGCGGCAGCACCTTGTCTTTCACATCTCGCAGCAGGACGCCGCTATTGTCGGCGAGTCGTTGAGGGTAGGCATGGATTGCTAATTGTCCGTATATTGTG
TCGACTGAAACTAACACTTGTACGCATCCACATGCACAACGTAGGCACTCAAGTGCTTTGAAGGCTCCGATAACTTGGTGCCGGTCCGTCGAGCAATGGC
CTTCCTGTTGGTTACTCAAGACTCGGATGGGTCGTGGAAGACCGGACCTTCTGCGAACGATGACTTGACGCATCAGTACTATTCGACCATGAGTGCACTC
CGTGCGCTCAGCGAGCCGCGCAAGCTCGGATTTGCGCCGGCGTTCCCTGACATCACTCCTTTGCTCGAGCTGCACCTGAATGCCGATATCGTAAGTGACT
GAAGGATGCGAATACCCACCTGTCGGTTTATAGCTGACTGTTTTCCACTAGGGATTGCCGCCACTCGAGATTACAGATGCACCGAAGACCAAGACCAAGA
CTGCCAGCGATGGCCAACAGGCGGCAACGGTGTCTTCGTCGCGCGATGCTCAAGTGGGGTCGGCAGCAGAGTTGGGCGGCGACTTGGCATTCAAGACGAC
CGATGCGGAGCCACCAAAGGCGGACGATCTCGAAGGCCAAGTGCGCTTCCAGCAGGGTTTGTTGGAGAACGAGGGAAACATCAAGCACGTGCCGGCCAAG
TTGGCCACGCACGTGCTGAACACGCTCTCGGGGATGCAGCTGACCGTCGACATCCTAAAGTCCACGGGGATTGGTCGCACGATCAACAAGCTCCGCAAGC
ATGCGGCGCCGGAAGTGGCCAAGGCGGCCGGTCAGCTGGTCGCCAAGTGGAAGAAGGATTTGCTGTAG