Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.17
Orientation:
(-)
Number of Exons:
1
Description :
Cryptochrome
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA photolyase, N-terminal33.921PS51645
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DNA photolyase, N-terminalIPR006050
*** None ***
InsideOutsideTMhelix
1-674
NN-scoreoddsWeighted Score
0.5221.2330.002
*** None ***
TypeScore
mitochondrial522
GO
*** None ***
KO ID
K02295
*** None ***
Sequence
        2025 bases(100 bases per row)
ATGGTCAGGATCGGGCCGCTGCCGAGCGGCAAGCGGCAGCTCCGGGTCGCGCCGACAGACAAGCTCGGGTCCTCGCGGTCTGCCCATCAATTGCGGCGGC
AGCAGCAGCCGACCAACGCTGGCGCTTCGGAGGCCGTTGGCGTATCTAGTGGCGAAGCCGACTGTCTGCCATCGAGCGCCAACCACTCGTCGCGACGCAA
ATCTGTCGCTGGATACCCACCATACCCAGTGTTGGCCTTCCCAGACCACGGTCGAGCAATGGGGGACAGTGTAGTGGAGCCGGAGTCGACCGAGTCGCTG
CGCCGTCGACGGCCACAGCGGCGAGCGCTCATCTGGTTCCGCCGAGATCTGCGGTTACATGACAACTTGGCGCTGCAGGGTGCCATCCGAGCGGCCACTG
GTCGAAGCGACAGTATGGAGTTGCTCCCGATCTACATCATCCACAAGCCCGTGCGGAAACGCTGCGGCGCCGTACGCTTCCAGTTCCTGCTCGAGAGTCT
GCGCGACCTGCACGAGTCTCTGACACGATCAAGGTCACGACTGCTCGTATTGCGTGGCGAGGCCGTCGAGGTGCTCCGAATTGTTTTGCCGGCCTGGGGT
ATCACCGATCTCTTCTTCGAGCAGTTCGTCATGCCGTACGCCATCGAGCGAGACGACAAGGTGCGCGAGATGGCTGCACAGCTCGGTGTGAACGTCACGT
CGTTCCGAGGAGTGACACTGTTCGACCCGCGCGAAGTCATCGTGAAGAACGGCGGGAATGTGCCAACCAAGTTTGAAGAGCTGCAGAACATCGTTCAGAA
CATGACTCAGCCAGCGCAGCCGTTACCAACACCCACCAGCCTTCCGCATGATATGACACTGTCAAGCAAAGATCTGTTTGAGCTGCTTTGCGACTACTGC
CGTTCTATCCGACTACTGGACGATGTGACAGCGCAACGCATAGCTGGAGTTTACGCAGGTGGACAATCTGTAGGAGACAAAGAAGGAACCGCGCTGTTTG
CAGTTCCCGAGCTGCGCGACTTTGGTCACGAGACACCGACCGAGCACTCGTTCCTGTTTGGCGGCGAGACGCAGGCGCTGCGGCTGCTGGACGAGTTCTG
CAAGGACGAGAAGCGGGTCGGGTTGTTCCAAAAGCCCTACACGTCGCCTGCGTCGGCGGATCGACCGTCCACCACTTCGCTGAGCGCGTACTTGTCGTTC
GGGTGTCTGAGTCCGCGCGAGTTCTTCTACCGCGTCATGTTCATCCAGCTCAAGTTCCCAGGACAGAAGGGTCCTCCCGAGACGACACTGGACGGCCAGT
TGCTGTGGCGCGAGTTCTTTTATTGCTTCTGCTCGGGCGTCCCGAACTTTGACACACAAGACCAGAATCCAATGTGCAAGCAGATCGCCTGGCGGCTGCC
GTACGAGCCTTCTCTCGACAATGGTACCGTCTTAGACAGTGATACCGTGCTGGCGATTGAACAACTGCAGAAGTGGAAAGACGGACGGACGGGGTTCCCG
TGGATCGACGCCGTGATGCGACAGATCAAGCGCGAGGGTTGGGCACACCACATCGGACGACACGCCGTCGCGGTCTTCCTCACGCGCGGCGACCTCTACA
TCTCGTGGCTGCGCGGCGCTGCCTATTTCCAGGAGCATCTCATCGACCTCGACTGGCCCATCAACATCGGGAATTGGCTCTGGGTCAGCTCGAGCTGTTT
CTTCCGCGACTACACGTCCATCCATTCGCCGTCACTCTACCCGCAACGATGGGATCCAGAGGGTCGCTATATCCGCAAATACGTCCCCGAGCTGCGCGAT
CTTCCCACCCGCTTCGTCTTCGAGCCATGGCGCGCGCCGCTCCGCGTACAGAACGAGTCTGGGTGTCTCATTGGTAAGCACTACCCGTTCCCCATGGTCG
ACCACCGGAACGCATCTCGCAAGTGCGTCGCGGGTGTTAGGAAGGCTCACGATCGTGTAGACGGACAGAGCGACGGCGAACAGGACGCCTATAGTGTCAA
TGTGGACGGCAAGCGGAGACCGTAG