Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.13
Orientation:
(+)
Number of Exons:
1
Description :
MYND finger domain protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain9.968PS50293
Tetratricopeptide repeat9.086PS50005
Zinc finger, MYND-type10.54PS50865
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat230SM00028
Tetratricopeptide repeat0.013SM00028
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, MYND-typeIPR002893
*** None ***
InsideOutsideTMhelix
1-193
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        582 bases(100 bases per row)
ATGGCCGACTCCCCGAACGCGCACATGGCGGTGGCGGACAGCAACGGCGCCGCCGCCGCATACATGGCGCTGGTGCAGCAGAGCAACGAGGCCGTGGCGC
TGGTGAAGGCGCACAAGTTCGCGGAAGCAGAGGTGCTGCTGCGCGACGTGCTGGCGCGCAAGCCGTCCGCGGGGTTCGACGCCGTCTCGATCGCCGTCAC
GCAGAATGCACTGGGGGAAGTGCTGCGGCAGCGCGGCCAGCTGGACGAGGCGCTCGAGCTGCTGAAGCTAGCGTTGGAGGTGCGCGAGCGCGACGACGCT
CAGAAGGAGATCACGTTTGCGTTGCGCGACGGGAACATCACGCGCGACGAGCTCGCCAAGGTGTTCGAGGCGAAGGGTGACTGTCCCACGGCACTCGCGA
CGCGGGAGCCAGGCAAGCGCATCTGCAGCAGCGAGACGTGCAGCGCGATGGACTACAAGGAGCTTCTTGCGTGCGCGCGCTGCAAGTGTGTTTTCTACTG
CGGGAAGGAGTGCCAGCGTCAAGACTGGAAGGCTCGCCACAAGCCGCTGTGTCAGTCCATCGACCGCTCTGCGGCTCCATGA