Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.42
Orientation:
(+)
Number of Exons:
3
Description :
Intraflagellar Transport Protein 57
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-386
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K04638
*** None ***
Sequence
        1396 bases(100 bases per row)
ATGGCGGACGACGGGGATGAAGCAATGGGGAACGCGGGGGAGCACAAGGTGGACGCGCCGCGCGACGACGTGGCCGTGACGCTCATGGGGGCCGTGCTGG
AGAAGCTGCGCGTGCTCGAGTACGACAAGGAGCTGGGCGGCAAGAAGAAGGGCTTCGCGCCGTACTCGGACACGCAGTTCGCGCTGCCAGCAGGTTCGAC
CAACGCGAGCGCGCAGTTCAAGGGCTTCCTGGAGCTCGCGACGCTGCTCGTACGGCTCAGCGGCCAGGAGCTCGTGGTGGACAAGTACGACGACCCGAAC
ACGTCGGTCAACAAGCTCATCCTGGTGCTCAAGGCGCTGGGCTTCCCGCTCGACTTTCCCGCTTCGAAGCTCAAGCCGGGCCACGGCGAGGCGTGCTGCG
CGGCGCTCGACTTCCTTGCGGACCGCGCGCTGGCGGCGAAGGGCTTTGCCTGGCCGCGGCCGCAGTACCCGAAGGAGGACTTCGCCGACGAGGCCGAGGT
GGACGACGAGGCCGAGGTGGACCCGGACGCGGACGAGGATGGCGGCGCGCACGGCCGCGCGGACGCCGGGGGCCAGGACGAGGACGAGGTCATGTACAGC
GACGTGGTGCTGCGCACCAAGGCGACGGCGGCGGCCGAGGCGGCGCTCGAGCAGTCGAGCAACCAGATGATCCTGAGTCAGGTGGACCCGCTGCTGTGGC
GCACCGAACTCGAGCGTGTCGGCCCCAAGCTGCGCACGCGGCTCGCGGCCGCGGCGACCNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGGACGCCAAG
GAGTGGCACGCGCACATGGAGCGAGCGCGCAGTCACGAGGCGGTGGTGGCGGCGCTGCGACCCGAGGCGTCGACCCAGCTCCGCGCGCTCGGGACGCAGC
TCGCGGACGCCGTGGAGCGCATGGGTGGCAAGGAGAAGGCGCTGTCGAACCAGTTCGAGACGGTGCGCAGCGAGTGCCAGGCTTTGGGCGAGCAGCTCGC
GGCGGCGGCGGCGCGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAACTCGCTGACCGGCGAGCACGCGG
CGCTGAGCGAGCAGGTGCGCGAGACGAAGGCCGTGATGGACGAGCGCAGCGCCAAGATGACGGACACGAGCCCGCTGGTGCGCATCAAGGACGCGCTCAA
GACGCTCGCGGCCGAGATCAAGCACTTCGACCTGCGGCTCGGCGTCGTGGGCCACACGCTGCTGCAGGCCAAGTCGCGCCAGGCGAGCGCCGCCTTCCGC
GGCCGCAACGCTGGCGGGCTCGCCGCGGGCGGCGGCGGCGGCTACCAGGACCNNNNNNNNNNGGAGCTCGACGCGAGCGACGACGACTCGAGCTGA