Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.0
Orientation:
(+)
Number of Exons:
8
Description :
Sodium/hydrogen exchanger
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Na+/H+ exchanger2.7PR01084
Na+/H+ exchanger2.7PR01084
Na+/H+ exchanger2.7PR01084
Na+/H+ exchanger2.7PR01084
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
sodium:proton antiporter activityGO:0015385IEA
integral component of membraneGO:0016021IEA
sodium ion transportGO:0006814IEA
regulation of pHGO:0006885IEA
*** None ***
*** None ***
Sequence
        3805 bases(100 bases per row)
ATGATGGACTCGACCGACGACGAGGAGACGCGCAAGCGCTGGACGGGCAGCGAGCTGCTCGCGTGCGCCGCCATCCAGCTCGTGCTCGTCAACGTGGCCT
TCCGCATCGACCGCCAGCAGCGCGCGCCGCTCATCTCGACCTCCTCCTGGGCCATCTTCTTCGGGCTCGTGGTGCGTCCCTCGGTCGCTGGCGGTGCTCT
CTTGACTGTCTTGGGTTTCTAATGCTTCCCTTGGCGTGTTGTTGTTGTTGTTATTGCTGCAGTGTGGAGCGCTGTTGACGTTCGTGTCGGAGGCGGTAAG
GGAGTAATCGTTGCGACGGTGGTACGGCATTGGGGACGTGATGACTAACAGACTCCCAATCTTCTGTCGCTGCAGCGCGCGCATGAGGCCGGACTCGACC
CGCAGATCCTGTTCTTCGGCCTGCTGCCGCCGATCATCCTCGAGGCGGGGTTCAACACGCAGCGCAAGGGGTTCTTCTCCAACTTTGCCGCCATCCTGTC
GCTCGCGATCGTCGGCACCTTGATCGCCACGTTCGCCACGGGCGGCATCCTCCTGGCGCTCGGCGCCATCGGACTCATCCCGCAGCTCACGTCGGCCGAA
GCCTTCCTCTTCGGCGCGCTGCTGTCGGCGATCGACCCGGTCGCGACACTGCTCGTCTTCAAGAAGTGCAAGGCTCCGCCTTTGCTCTTCAACCTCGTGT
TCGGAGAGAGCGTGCTCAACGACGCCGTCGGTACGCCTCCGAGTCCTGTGGGTTTAGACCTGACGCAGTGTTAACAACCTTGATTATCGTGTGTCGCGTG
CAGCAATCGTGTTGTTCACGCTGTTCCAGAACCTGATCTCGACAGGCAAGTCGGAGCTGGACTTGCTGTCGACCTGCAACATGATGGTGCAGCTGATCGG
CATCATGGTGGGGTCGATCGCGCTGGCCGGCGCCATCTGCTACTCGTCCGCGTACCTGCTGCGGCACTCAGACCCGTCGCTGCGAGACCACCCCGTGTAC
GAGATCTCCATCATCCTGCTCTCATCGTACGCGAGCTACCTGGCGGCCGATCTGATCCAGCTCAGCGGCATCCTGGCCGTCTTCTTCAGTGGCGTCTTCA
TTCGCCACTACCACATGTACAACATCTCGAAGGGGAGCGCGTACGCCTTCACGCAACTGCTCGAGACCATCGCGTTCCTCGCCGAGAACTTCATCTACCT
CTACCTCGGCATCAGCTTGATGGCGTACCGCCTGTCGTTCGTGTGGAACTGGCCGTTCATCCTCGCCACGTTCGCCGCCTGCCTCATCGCGCGCGGGTTC
AACACCTTCCCGTTGTGCAGCCTCGCCAACCTCGGCCGCTCGCCGCGGAGCAAGATCCCGCTGTCGCACATGGTCGTCATCTGGTTCTCCGGACTTCGTG
GGGCTATTGCCTTCGCGCTGGCGCTCAACGTGTACACGACCGACCCGAGCCACGCAGCTATCATGAAGAGCACGACGTTGTTAATCGTGCTGTTCACTAC
GGTGTTCCTCGGGATGACCACTGGTCCACTGCTGGACTCGCTGAGTCTGAGCGGCATCAGCGCCAAGACGGGCGAGGTCAACACCAGCGCGAGCGAGGCA
GAGACCCAGCCGCTGCTTCCCCCGCCGCTCTCGACCCCTCCAGGCTCCGTCAGCGTGCACACTGCGTGGGTCGACATCGACGAGAAGTACCTGAAGCCGG
TGTTCGGTGGTCGACCACGTTCCCAAAGCGATTCGGGTGTCCCAGCAGCGTGGCAGCCAAGTGCGTAGGTAGCGGGAGCTCGACAAGGTTGTCGCAGCAA
CGGTAGTGCAGACTGTGTAGAGGGACGACCGAGCATCGGTTGCGATGTAGTCGACCAGTTTGAGCGGGGCCGCGTCCGGATACGGCGTGACGGCGCTCGT
TGTGTGAAGTGTGGAGTGAATACGCGACTGTTTCTTCAACGAGCGAGCTTGTCTCCCTGTCTCCTCCGCTCGCCGTGTCGCGCAGCTCGACGCCAACGGT
GGCATCCACTTTTTTTTTTGCGAGACTGACCATGAGCATCGGCGTGGTGGAAGTGGAGCGAGCGCAGAAGCGGTGGGCTGGCGGCGAGCTGCTGCTGTAT
GCGGCCATGCAGCTGGCGCTGGTCAGCGTCGCGTACAAGATCGACCGCCGGCGCAAGGTGCCTCTCGTGGCGACGTCGTCCTGGGCCATTCTCCTCGGCT
TGGCGGTGCGCGCTGTCGACTCGTTCTCGATGTATGCGACTTCTCTTCTGATGTTTTCCTGGTTGATTCTGACAGTGTGGCGCTGTGCTCGCGCGCTTGT
CCAAGCGGGTAAGTTTGATCCTTGCTGCTCTTTGTTCGATGTTCATACCAACCGAGCAATGCATCATCTCCACAGAGAGTCGACGAAGCTGGCCTCGACC
CTCAGATACTCTTCTTCGGCTTGCTGCCGCCGATCATCTTCGAGGCGGGGATCAACACGCAGCGCAAGGGGTTCTTCTCCAACATCGTGGCCATCCTGCT
GCTCGCCGTGGCCGGGACGCTGATCGCCGCGTTCGCGACTGGCGGCGTGCTGATCTGGCTGGGCAGTCTGAACGTCATCCCAGCGCTGACGGCGGCCGAG
GCGTTCATGTTCGGAGCGCTCATCTCGGCTGTGGACCCGGTGACCACTCTTCTCGTCCTGAAGAAATGCCGCGCGCCGCCTTTGCTGTTCAACCTCGTGT
TCGGTGAAAGCGTCCTCAACGACGCAGCTGGTAAGAGACACTTCACTACATTTGACTGCATCCGCAGCTGCTTGCTCATGCCTCGACCATATCTGCCGCA
GCGATCGTGCTGTTCACGCTATTTCAGCAGGTGGCGGCGACGCCGGACGCTCAGGTGGACGCATGGACAGTCGGGTGGCTGTCGCTGAGACTCGTGTTCA
TCATCGTGGGTTCGGTGCTGCTGTCGGGAGCCATCTGCTACTCGTCCGCCTACCTGCTGCACCACGCAGACCCGGCGCTGCGACAGCACCCAACGTACGA
GATCTCGACGCTGCTGCTGTCCGCATACGCGAGCTACCTGGCGGCCGAGCTGGTGGATCTCAGCGGCATCCTAGCGGTCTTTTTCAGCGGTGTGTTCATC
CGCCACTACCACGCGTACAACGTGTCCAAGGCGAGCGCGTTCGCGTTCAAGCACCTGCTCGCCACGCTCGCCTTCCTCGCCGAGAACTTCATCTACCTCT
ACCTCGGCATCAGCTTGATGGCGTACCGCCTGTCGTTCGTGTGGAACTGGCCGTTCATCCTCGCCAGCTTCGGCGCGTGTCTGCTGGCGCGCGCGCTCAA
CGTCTTCCCGCTCTGCGCGTTCGCGAACCTCTGGCGGTCGGCGCGCCACCAGATCCCGGTGAAGTACATGGGAGTCATCTGGTTCTCGGGACTGCGCGGC
GCCGTGGCGTTCGCGCTGGTGCTGAACGCCGAGACGATGAACCCTACTCACGCGGCCATGCTCAAGAGCTCGACGATCTTCAACGTGCTGGTCACGACCA
TGGTGTTCGGCGCGCTTGTCGGGCCATCGCTGCAGCTGTTCAACATCGGGAGAGAGATACGGCCGGGTCGAGGACTAGCTCGAGGACAGCACGCGGGCGA
ACGCAGCGACGTCGAGAGTGGTGGCGAGCGTCAACCGTTGCTGCAACCACCTCCACCGGCCCCGTCGTCCCCGCCCAGCCTGCGCAGCGTCCGCGCCGCG
TGGGTCAAGCTGGACGAGACGTACCTCAAGCCGGTCTTCGGTGGGAGGCCGCGTCCAGCGTGCGAGGAGCCGACGACGCAGCTTTTGCCTTTGTGGGAGG
AGTGA