Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.46
Orientation:
(+)
Number of Exons:
4
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-206
NN-scoreoddsWeighted Score
0.7312.3140.005
*** None ***
TypeScore
nuclear783
GO
*** None ***
*** None ***
*** None ***
Sequence
        788 bases(100 bases per row)
ATGCAGGAACACGATATCTACAGCGGCATCCACTCGGACGCAGCAGCAGAGAGTGAAGACCAGCAAAGTGACGCACCTCGATTCGTTGAGCTGAGCGGTG
ACAAAGACGACCTGGCTGGATCAACAGACAACCAAAAGTGAGTCATCCACACTGAAGGTAAAGATGTTACATTCATGATGCTCACGAGCTACCAGTGACG
ATCCTAGCGCGGAAGATGAGACACATCGGCGATACCGAATCATCGCCGAGTCGTTTGACGGCGTCAAGGTGAGCTAGATTGACTGGAGGCATTCTCTCCT
GGCTGTACGTGTCGGAGCTTTCCTAACTCATTCGAGATACTTTGTCACGAAGATCATTCCACTGGCGGGATCAGTCCATGACTTGTACACGAAGAAGCGT
TACGCGCACCTCTTCGACGCTGTGTTTCTGTCGGCGCAACAAGCACACACTCTACAGCCAGCAACCGAAGCCCAGGAAGACGCACGCACTATCACAAGCA
TCCTCACCGACGCCTCCACCATTGACGTCGAGTCTTCCATGTATGTCCTCCGTGTTGTGGATTGTGTGTCGACACACTGCGAATGCATACCTGACCCCAC
ATTTGAGATGCAGGTTTATGCTGCCGTTGAATGACGAACAACGGATCCAGTTCGTGCAGAAGCTGTTGGAATGGGCTCCCTCGCTCCATTGCACTGCCTC
GACTCGTTTCTCAAGCAAAGACGGACCCAGCAAGGAGGACATGGCGCAGATCAGCAATGCTACTCTTCGGTTCCAGTATGCGCGCTAG