Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.48
Orientation:
(+)
Number of Exons:
4
Description :
SF-assemblin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
SF-assemblin2.1PR01799
SF-assemblin2.1PR01799
SF-assemblin2.1PR01799
SF-assemblin2.1PR01799
SF-assemblin2.1PR01799
SF-assemblin2.1PR01799
SF-assemblin2.1PR01799
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-275
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
structural constituent of cytoskeletonGO:0005200IEA
*** None ***
*** None ***
Sequence
        1022 bases(100 bases per row)
ATGAGCAGCGAGGACACGGAGAGACGCGATGTCGTCGACGCAAGCGAGAGCGCGGCGGAGAGTGAACTGGCTGCGACTGCAACCAAGCACAAGCTCGAGA
AGCTGATGACGGAGTTTGCCGAGTTTGACGACGTGATGCGCATCGGAACGAGGGTGAGAGCGCTGCTGGCACTGTTGTTGCCGATGCGGGATGTGGTCTG
AACAGTGTGTCTCGCATACAGCAACGCCGGGAGAAAGACGAGTACCGCCTCGCCGAGATGAAGCAGGAGATGAGTCGCTTGGAGGCGAAGCTCGAGGTTG
AAACAAAGAAGCGGATCGAGATGAACAAGTCTCTGCAGAACTATTGCGACGAGCAGGTCACGCAGATGACAGCCAACTTCGAGTCGCTGCTTGACGAGCG
TGCCAAGCAAGTTGACGCGCGACTGAACCAGCTTTCGCAAGAAATCTCCAGCCTCGACGCGCTGGTTGCGCAGGAAAAGCGCGACATTCCGCTCATGATC
GAGCAGAAGACGAACGAGTTGACACAGAAGCTGGTCGCGTTCATGGATGCGTTCGAAGCTGAGCGGAAGCGGCGCGCGGACCAAGAAGCTACGCTGTTGA
CTCGATTAAGCTCGCATGAGCATGCGACAGCCGAGGCGTTCGAGCGCGAACGAGTGAGTCGCCTTTTGGTGTTGTGTCAATGTTCACACGGCTAACGCTG
CTGCACTTCCAGAATGACCGAGAGCGCAAGTACGCCGAGCTCAAGAACGCGCTGGACGCGTACACAGAAACTCGGCGGCGCGGCGACGATCGTTTCGCGG
CGTTCGCGAGGGAGGAGATCGCGAAGATTCAGAACGCGCTGGTGGCGGAGGCGCAGGTAATGTTGCAAGAAGCGTCGGGCATGCACTTGGATCGTTGCTG
ATGGAGGATTCTATTGCTGGCAGTCACGCGAGCGCGAGGACGACGAGATCCTCGAGGCGCTCAACCGGTACACGGCCAAGCTGCAGGACAGCCTCAAGGT
CATCACTGGTCCGGACGCATGA