Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.27
Orientation:
(-)
Number of Exons:
4
Description :
Nucleolar GTP-binding protein 2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
GTP binding domain4.4PR00326
GTP binding domain4.4PR00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-704
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
KO ID
K14537
Cluster Id
3918
Sequence
        2643 bases(100 bases per row)
ATGGCCAAGGGAATCAACAAGACGAAGGCGTCGGCCGACAACCCGCATCGACAGGTGCCCAAGCGGCAGAAGGCGGCCAACATGCGCGACAAGTCGACCA
TCAAGCGGCTGAACATGTACCGCAACAGCGGTCCGATCCGCAACAAGGGCGGCAAGGTCGTGGGAGGCAGTCTCATGATGCAGGGCAAGACTGGCGGACA
GGAGATCACGGCCACGACTGGCCGCATCGCGCCGGACCGGCGCTGGTTCGGCAACACGCGCGTCGTGGGACAGAAGGAGCTGGACAAGTTCCGCAACGAG
ATGTCGCTGAAGGCGGCTGACCCGTACTCGGTCGTGCTGCGCTCGCGCAAGCTGCCGATGGGTCTGCTGAAGGAGTCGGACAAGGTCGCGCGCATGAAGC
TGCTCGAGACGGAGAGCTACGAGGACGTGTTCAACGGGAAGCGGTCGCGCAAGCGCGCCAAGATCGCGGCCAACGACCTCGAGTCGCTGCTGGCCAAGGC
GCAGGAGGGTGCCGAGCAGTACGAGGCGCGCGGCTCCGACCGCAACATTGTCGTGGAGCAGGACTTCAAGGAGGAGGTGTCGCACGACGTGTTCAGCAAG
GGCCAATCGAAGCGCATCTGGGGCGAGCTCTACAAGGTGCTCGACTGCTCGGACGTGGTCATTCAGGTGCTCGACGCGCGCAACGTGCCTGGCACGCGGT
GCGAGCACGTGGAGAAGCACATTCGCAAGCACGCCGCGCACAAGCACCTGATCTTCGTCATCAACAAGTGCGACCTCGTGCCCAACTGGGTGACGAAGCG
GTGGGTGCAGAAGCTGAGCGAGACGACGCCCACGCTCGCGTTCCACGCGTCGCTGAGCAACCCGTTCGGCAAGGGAGCGCTGATCAACCTGCTGCGGCAG
TTCGCCAAGCTCCACCAGGACAAGAAGCAGATCTCGGTTGGGCTCATCGGCTACCCGAACGTGGGCAAGTCGTCCGTCATCAACGCGCTGCGCAAGAAGA
AGGTGTGCAAGGTGGCTCCCATCCCTGGCGAGACCAAGGTGTGGCAGTACATCACGCTGATGCGTCGCATCTTCCTGATCGATTGTCCCGGCATCGTGTA
CGACACGGGCGACGACGAGGTCGAGACGGTGCTCAAGGGAGTCGTGCGCGCTGAGCGTCTGCCGCAGGCGACCGACTTCATCCCCGCGATCCTCGAGCGC
GTCAAGCGCGAGTACCTCGTCAAGGTGTACGGCGTGGACGAGTGGAAGGACGAGTGGGAGTTCCTCGAGAAGCTGGCCAACAAGTGGGGCAAGCTGCTGC
AGAAGGGCGAGGCCGACTTCAACAACGTGGCCGTGCAGATCATCAACGACTACCAGCGCGGCAAGCTGCCGTGGTTCGTGGCCCCTCCCATGCGTGCCGA
GGAGCTTGAGGCGCTCGAGAAGGCCGGTGGCGACGACGAGCCGCTTAACGTCACGGCCGCTGACGAGGACGAGATCGTCGAGCTCGAGGGCGATGACGAT
GACGATGAGGAGGAAGTGAAGGAGGATGCAGACGAGGACAAGGACGAGAGCGAGGAGAAAGAGGACGAGGAGGAGGAGAAGGCCGAGGCATGAGGCTGCA
AGCACCAATGCCTTGATGTAGACGGTATTAGAGCGGCGGTATCGGGATGGCGATCCCTTGTGCATGAATGAATATTCGATCCTATCACATTTCCTGAACG
GACGCGACCGATTGCCATTTGCTCGAGGATGTCAGAAGTACAGACAGATACGACGCTCAAGCAAACCGAGGACGCCAACAAAGAAGCCACTGCCGAGACC
TCCACACAGGTGACATTGGTGTCTACTGCCTCGATCGTCGCAGGCCACGAATCATCGTTCTAGTGCTGCTGCTGCCTTCTAGCTCTCGACAGTGGAGCGA
CTTCGTCGAGCTCGACAAGCGCACGAGGCGCTGCGGCGTGCGGCTTCTCGTCCGCCTTCCGTGTCCGTCGTCTCTGAGGCATCGTCTGCAAAGCACGAGG
CGCCGCCGATCTCGTCGGTCGCGAGTCTGGCGTCGCAGCTCGACGCATTCTACCAGTGCGTCAAGAGCAGACAATCCGCTGACGGACAGAATGCGAACGA
TCAGCGACAACTCGATCGACTGCGCGCGTCGCTAGAAAAGATCGGTGCGGACGAGAAGAACGACCTCGTCCTGTTCCTCCTGCAGCAAGTCGATGGGGTC
CGCGCACAGCGCAACGACGCAACCGCTCTAGGCGAGCACATTGCTGCTCAACTCGTTCGGCAGCAGGTGACCCCAGTCACGAGAGTTGCGCTGCTCTGAC
ATCTCCACGATTGACTGATTCATATCGCCTTCGCTGCACAGCACGAGCTTCGACAAAAGTGCCGAGAGCGCGTCGATCAGCTGGAGAGCGAGCTGCACCA
AGCGCTGCACGCGCATCCAGAGGTCACAGCGCTACGGTCTCGAGTCCAAGAGTTGACGGACGCCAACCGCGACCTGGAGCAGCAGCTGCGATTCTCGGTC
GGTCACCATTTTGCATTCAAAGATGCAGGATCGCTCTAACTCACCATTTTTACCGAGTCGCCTCGCAGGTGGTCAAGCTCCAGCGCAGCAGGAAGCGCGA
GCGAGAGCTCCAGCGGCTGCACGATCCGCTTTGGGACATGTAG