Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.25
Orientation:
(-)
Number of Exons:
5
Description :
Di-N-acetylchitobiase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Chitinase II1.5SM00636
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6370.73621
InsideOutsideTMhelix
1-432
NN-scoreoddsWeighted Score
0.6751.8910.004
*** None ***
TypeScore
endoplasmic reticulum333
GO
Biological ProcessGO IDPrediction Method
chitinase activityGO:0004568IEA
chitin catabolic processGO:0006032IEA
*** None ***
Cluster Id
1918
Sequence
        1578 bases(100 bases per row)
ATGAGCCGAGTGCTGGCGGTCGTCGCGCTGGTGTTGGGGGCGGCCGGCGTCGCACGCCCCTTCCGCCCGACCGACCTAAGCATCCAGGCCGTTCCACAGA
CAGCCGACCCGACGCTAGCGGATGCCGAGCGCTCGTGGGTGCGCGGCTGTCCGTGCGAGCAGTGGCACGCGAATGAGATTGACGCGAACCGGCTGTGCCT
TCCGTTGGCGCGGACGGCAGCGGCGGCCCGCGCTCTCGCCATTCGGAAGGAGGTGTTCGTGTTCTCGATCACCTCCGACGACCGCTGGAAGCACTACGAC
TGGGACACGGTGCGTTCGTTTCGAACGAGGAGGGGTGTGTTGTGCTAACTGGTGGGGAATGCTGGCTGGTAGGTTACGACCGTGGCGTGGAACACCGACA
AAGAGCTGGTGTGTCATGCGCACAAGAAGGACGTGCGCGTGGTCGTCAAACACAACTTCGACGCGGTCAACCAGCTGTGCAACCTCACGGCGCGCCGCGA
GTGGATCCAGGTATCGCACCAAACCAGCGTTGCACGAGTCTCATGTTGCTAACTATGGTGTCCGTCCATCTGCAGGCGACGTACGAGCTGATCGAGACGA
ACTACGCCGATGGAGTCAACATCGACACGGAACAGCCAATGAACGGAAAGCCGGCCGAGTGCCTCGCCGAGCTAGTTCGTGAACTTCGAAACGAGCTGCA
ACGCCACCCGCTGACCCAGTACGCCCAGGTTAGAGAGCTTCGCGTTCTCTCTAAGCAAGTGGGTTATCTCGTCTCACGCGCTCTTGGCTCCGACAGATCA
CGTTCGATGTGCCATGGGCTCCTCGGGGTGTCGACGGCAGGTACTACCCGTGGAAGGAGCTCGCTGACGCCAGCGACTTTCTGTTTGTCATGGCGTACGA
CATGCGCAGCCAAATTTACGACGCGTGCATCGCGGGTGCCAACTCGCCGCGCGCTCTCGTACAGCAAGGCATCGACGAGTTCCTGGTCACTCACGGAGTT
CCCGCCGACAAGCTCGTGCTCGGCCTTCCCTGGTACGGTTACGAGTACGAGTGCCAATCAACTGGTCTCGAGACCGGCGGTGGTGGTGGCGACGCTCCTG
TCGTCTGTCCAATCCCGGCGGTGCGTTCGAATTACTGTGCATGATGAGCTGCTGAAATGTATGGCTCATTCTAATCCTCTTGCATGTGCCTTCACTGACC
CAGATCCCGTTCTTTGGCGCACCGTGCAGCGACGCCGCCGGCCGACAGCTCGACTTTGCAGTCATCGACCAACTTGTCCATTCCGAGGATCTCACCGTCC
AATGGGACGAAATGTCTGAATCGCCGTTTGTCTGGCGACGACGTCACACCGATACCGGCCTGTCCATTCGGTCACTCACACTGACCCAGCTGTGGTTCGA
CAACGTCACGAGTTTGGAGCACAAATTTCAGCTCGTGCGCGCTGTGGGACTGCGCGGCGCCGGTGTGTGGCACGCGGACGCGCTCAACTACTCGGCGCCA
GTGGCCACTGCGGCCAACAATGCCACACAACGGATGTGGCAGGCGCTCAAGTCCGCCGTCGCGACACCGCACGAGTAA