Transcript Name :
Pytve_DAOMBR484snap_masked-pve_contig_1-abinit-gene-0.99
Orientation:
(+)
Number of Exons:
3
Description :
Histone transcription regulator HIRA
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-94
NN-scoreoddsWeighted Score
0.9156.0990.012
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
*** None ***
Sequence
        636 bases(100 bases per row)
ATGTCGGATGCGCTGGTGCAGCGAAATGTTACTCGCTCGCACCTGGAGCACCAGATTGCTGCAGCGATAGCATTGAAGAGTTCGGCAGAGTACCGCTACT
GGTGAGAAGCACGCTGAAATTGTTGTCGTCGCATTGGATCTGCTGTTGACGTTCGGCGCATTATTTGTGGACTGGCAGGATTGAAGCGTATGTCAAATTT
CTCGCGCAAGACGAGGATGTATCTCGGTTGGACGGCCTATGCGCCGAGATGATGGGACCCTTTCACGCGTACGTTGGTTGTCTTTATCATTTCATGTTGC
CGTCTCAGCACGTCGGATCGTGGACTAACAATGGTGGGATGAAGCCCGAGCATTTCAGATGACGTTGCAGCCAAAGCTACCTCATCTAGCGACAATGACA
GTCTCTGGGACTCAATGGTGTTGGTAAGTACCTTGTTTTGTGCAGTGATAGACGATTCAATTGGCTCTAACGTGCTCATTGGCAACGGGCAGGATATGTC
AAAGCGCGAAGTGCTGAAAACGCACATTCTCCCAACGATGGCGGCAAATCGCAGCTTACAGCGGGTTGTGACGAAGTTCCAGCTCATGCTAAGCGAGATC
GACGAGCGCGAAAAGGTTGCCGCGGACGAATCCTGA